Как готовится квашеная капуста: Квашеная капуста — пошаговый рецепт с фото. Автор рецепта Кристина 🌸 .

Содержание

Квашеная капуста на зиму в собственном соку

Квашеная капуста в собственном соку: Pixabay

Кто из нас откажется от хрустящей квашеной капусты в дополнение к жареной картошке или другому блюду? Конечно, есть и те, кто от такого блюда не в восторге. Если вы не из их числа, предлагаю приготовить вкуснейшую заготовку самостоятельно. Расскажу, как готовится квашеная капуста на зиму.

Квашеная капуста на зиму: рецепт, ингредиенты

Капуста квашеная — одно из главных блюд зимнего сезона. В моей семье такую закуску начинают есть осенью, когда заканчиваются салаты из свежих овощей. Тонко нашинкованная капуста с солено-кисловатым привкусом — желанный гость на столе. Я подаю ее не только как самостоятельное блюдо, но и добавляю в винегрет, тушу для пирогов или вареников.

Читайте также

Лечо — салат: рецепт в домашних условиях

Многие покупают уже готовую квашеную капусту, однако это не обо мне. Я предпочитаю готовить большой запас этой закуски. Готовлю капусту в собственном соку, без маринада.

Рецепт квашеной капусты на зиму до смешного прост. Запаситесь такими продуктами, как:

  • белокочанная капуста — 2–2,5 кг;
  • морковь — 1–2 шт.;
  • соль и сахар — по 1,5 ст. л.

Из такого количества ингредиентов получается трехлитровая банка вкуснейшей закуски. Отмечу, что я квашу капусту именно с морковью. Многие не добавляют овощ вообще или кладут его в небольших количествах. Это дело вкуса.

Готовая квашеная капуста: Wikipedia.commons

Еще один важный момент — количество соли и сахара:

  1. У всех разные ложки, поэтому многие хозяйки жалуются, что капуста в итоге получается несоленой или слишком кислой. Чтобы этого не произошло, рекомендую попробовать капусту после того, как проделали все указанные манипуляции.
  2. Овощи должны быть хорошо солеными, иначе процесс брожения не пойдет. Если кажется, что пересолили, добавьте сахар.

Читайте также

Курица в банке с картошкой в духовке

Чтобы заготовка удалась на славу, соблюдайте несколько правил:

  • выбирайте упругие кочаны белокочанной капусты без повреждений;
  • лучший овощ для закваски — тот, который собран в октябре–ноябре;
  • капусту шинкуйте тонко.

Рецепт квашеной капусты часто включает клюкву, яблоки, бруснику и другие дополнения. Также можете приправить капусту перцем горошком, лавровым листом или другими специями по вкусу.

Квашеная капуста на зиму: приготовление

Квашеная капуста на зиму, рецепт которой уже узнали, готовится несложно. Наиболее трудоемкий процесс — нарезка главного овоща. С морковью поможет крупная терка (натрите), а вот с капустой придется повозиться. Не рекомендую использовать кухонные гаджеты: результат получится не такой, как нужно.

Поскольку не у всех есть возможность хранить такую закуску в дубовых бочках в погребе, то изучим, как готовится квашеная капуста на зиму в банках. Помимо основных ингредиентов, запаситесь острым ножом, большой разделочной доской и трехлитровой стеклянной банкой. Можно квасить капусту и в другой таре, если она не алюминиевая. Однако в таком случае понадобится гнет.

Читайте также

Заливной пирог на кефире и майонезе с капустой

Рассказываю, как квасить капусту на зиму:

  • Оборвите верхние капустные листья. Очистите морковь.

Подготовка овощей: YouTube/Татьяна огородница

  • Мелко нашинкуйте капусту. Идеально, если брусочки будут длиной не больше 5 мм.
  • Морковь натрите на крупной терке.
  • Смешайте овощи, посолите и посахарите.
  • Теперь необходимо хорошо размять капусту с морковью руками, чтобы овощи пустили сок. Мне удобно делать это прямо на столе (предварительно вымытом, разумеется). Однако можете сложить заготовку в таз.

Капусту смешиваем с морковью: YouTube/Татьяна огородница

  • Овощи стали мягкими и пустили сок? Самое время утрамбовать их в банку. Горстями складывайте солено-сахарные брусочки в банку, утрамбовывая их руками, скалкой или другим удобным способом. Слои должны ложиться очень плотно.
  • Поставьте банку в тазик: в процессе брожения выделится сок, который может выбежать из тары.

Читайте также

«Тещин язык» на зиму из баклажанов: рецепт

Квашеная капуста в банке готовится 3–5 дней. Для нормального процесса нужна комнатная температура, поэтому тару на холод не выносите. Вот как поступаю я — оставляю банку без крышки и регулярно протыкаю салат ножом, чтобы выходил углекислый газ. Это обязательное условие хрустящей капусты, без неприятного запаха и вкуса.

Капуста в банке: YouTube/Татьяна огородница

Когда квашение капусты закончится, закройте банку крышкой и переместите заготовку в холодильник или погреб. Если готовили салат не в банке, храните капусту под гнетом.

Вот и все секреты приготовления любимой многими закуски. Квашеная капуста в собственном соку вкусна в любом виде, однако я предпочитаю подавать ее с полукольцами репчатого лука и заправлять растительным маслом. Попробуйте сделать угощение для родных по предложенному рецепту и расскажите в комментариях о своих секретах приготовления квашеной капусты.

Читайте также

Аджика из сливы: грузинский рецепт

Оригинал статьи: https://www.nur.kz/family/food/1765687-kvasenaa-kapusta-na-zimu-v-sobstvennom-soku/

Почему капуста мягкая при квашении. Как готовить квашеную капусту: решающие хитрости

Почему капуста мягкая при квашении. Как готовить квашеную капусту: решающие хитрости

Несколько простых рекомендаций позволят приготовить капусту правильно, чтобы она хрустела и сочетала в себе идеальные пропорции сладости, кислоты и соли.

  1. Чтобы капуста сохранила свою упругую форму, её нельзя слишком мять во время пересыпания солью. Тем не менее, продукт должен пустить сок, поэтому её утрамбовывают деревянной колотушкой, а поверх заготовленного сырья в бочке или банке всегда ставят груз.
  2. Добавлять сахар в квашенную капусту рискованно. Из-за этого в тепле капуста может слишком быстро забродить и испортиться. Поэтому выбирают сладкий сорт, но дополнительно сахар в заготовку не сыплют.
  3. Для аромата к капусте добавляют морковь, но здесь тоже важно не переусердствовать. На каждый килограмм капусты достаточно 30 г натёртой моркови.
  4. Также для хруста и пряного аромата пригодится лавровый лист и перец-горошек — по штучке на каждые 1-2 килограммов будет достаточно. Дубильные вещества лавра не дадут капусте подгнивать и увядать.
  5. Опытные хозяйки рекомендуют шинковать капусту поперёк прожилок, тогда она лучше сохранит плотность и форму.
  6. Если нарезка даёт мало сока, допустимо подлить кипячёной воды. Рассол делают из расчёта 1,5 столовые ложки соли на 1 литр воды.
  7. Каждые пару дней прикрытую ёмкость нужно открывать и протыкать капусту, чтобы из толщи массы высвободились газы — именно из-за их избытка капуста может получиться мягкой, слизистой и даже потемнеть.
  8. Также немаловажно, в какой ёмкости готовится блюдо. Квасят капусту в деревянных или эмалированных бочках, либо в стеклянных банках. В металлической таре капуста моментально темнеет и окисляется.
  9. Держать капусту во время квашения нужно при средних температурах, а по готовности убрать в холод. Если температура будет выше 18-20 градусов, капуста может перекиснуть раньше времени, а в холоде — наоборот не просолиться. На каждый килограмм сырой соломки берут 20 г соли, больше — не страшно, но тогда в результате блюдо будет пересоленным на вкус.

Почему темнеет квашеная капуста

Несмотря на то что процесс приготовления квашенки прост и не требует специальных навыков от хозяйки, сам химический процесс, происходящий внутри овоща, сложен и чувствителен к нарушению технологии. Одним из отклонений в результате неправильного приготовления является потемнение продукта.

Если капуста стала серой, это негативно сказывается, во-первых, на товарном виде пищи, а в отдельных случаях может повлиять на вкусовые качества заготовки или вовсе погубить продукт. Потемнение может произойти по нескольким причинам, о которых поговорим ниже.

Неправильное количество соли

Квашение — это заготовка овоща с помощью молочнокислого брожения. Для этого используются лишь белые части овоща, не слишком перетёртые. Именно благодаря молочной кислоте овощ консервируется и становится кислым. Данный химический процесс невозможен без участия соли. Соль нейтрализует плохие бактерии и усиливает консервирующее действие молочной кислоты.

Именно благодаря соли квашенка может храниться и не портиться, поэтому в данной химической реакции она является одним из ключевых элементов. Соль должна быть поваренная, крупного помола (ни в коем случае не мелкая) и без примесей. Использование йодированной соли, гималайской и прочих приведёт к другим химическим процессам и может стать причиной потемнения.

Важно! Несоблюдение пропорций может отрицательно отразиться на качестве вашей капусты. Недостаток соли замедлит процессы брожения, а избыток — может привести к уничтожению полезных бактерий. Оптимальной пропорцией считается 20–24 г соли на 1 кг капусты.

Несоблюдение температуры и времени брожения

После засолки процесс брожения делится на три этапа, каждый из которых предполагает разные химические процессы, требующие индивидуальных условий внешней среды:

  1. Первый этап — это активное размножение молочнокислых бактерий. Поваренная соль, положенная в процессе заготовки, вызывает плазмолиз клеток овоща и провоцирует испарение влаги из выделяемого сока. Благодаря плазмолизу активные вещества переходят в рассол. По мере испарения влаги будет испаряться соль. С этого этапа начинается развитие молочнокислых и других бактерий, среди которых первые со временем занимают преобладающую позицию. Рассол характеризуется помутнением и повышенным газообразованием. Длительность этого этапа зависит от температурного режима. Наиболее благоприятными условиями для правильного протекания процесса является температура +17…+24°С, при которой достаточно 2–3 дней для перехода в следующий этап. Низкие тепловые показатели вызовут замедление брожения, что нарушит всю дальнейшую технологию, а высокие — повлияют на образование плохой микрофлоры.
  2. Второй этап характеризуется выделением молочной кислоты. Лучшим условием для процесса брожения будет температура в пределах +20°С на протяжении 5–7 дней. Это обусловливается размножением молочных бактерий и торможением негативных реакций. Если всё выдержано правильно на этом этапе, овощ сконцентрирует в себе максимальное количество витамина С.
  3. Третий этап — это дображивание, которое должно проходить при температуре не выше 0°С (и не ниже –2°С). Повышение температуры спровоцирует развитие плесени, что полностью испортит продукт и сделает его непригодным для употребления. Время дображивания занимает несколько месяцев.

Квашение капусты. Как квасить капусту в домашних условиях — полезные советы

Первый наш с мужем опыт при квашении капусты закончился фиаско. Это было очень давно, в те времена о компьютерах и интернете мы еще не подозревали, рецепты переписывали друг у друга в блокнот. Но о тонкостях приготовления квашеной капусты я стала интересоваться позже, когда пришлось выбросить ведро капусты. Дело в том, что мы купили «неправильную» капусту летних сортов, и она после закваски стала мягкой как каша. С тех пор прошло много лет, мы набрались опыта, которым и хочу поделиться с вами.

  1. Главное — купить или вырастить капусту для квашения необходимо только поздних сортов. Летняя капуста совершенно для этого непригодна. У капусты летних сортов листья более тонкие, зеленые и рыхлые. Зимние сорта капусты отличаются плотным кочаном и белым цветом. При выборе капусты обратите внимание, чтобы она не была слишком «жилистая», с жесткими прожилками.
  2. Резать капусту для квашения следует не очень мелкими кусочками. Толщина каждого кусочка должна быть где-то 5 мм. Если слишком измельчите капусту, он станет мягкой.
  3. Для квашения капусты используйте нейодированную соль крупного помола.
  4. Подойдите ответственно к выбору тары. Для квашения подойдет стеклянная, деревянная или эмалированная без сколов, посуда. В алюминиевой кастрюле молочная кислота, которая образуется при квашении, вступит в реакцию  и испортит вам  все дело.
  5. Квасить капусту следует при температуре не выше 24 и не ниже 20 градусов. Перегреете — получите кисель, а в холодном помещении капуста просто не закиснет.
  6. Процесс брожения занимает примерно 3 дня, После этого капусту можно, конечно, есть. Но настоящий вкус классической квашеной капусты появится только через неделю.
  7. Нашинкованную капусту для закваски обязательно нужно прижать чем-нибудь тяжелым, например, тарелкой с 3-литровой банкой огурцов. Моя бабушка всегда держала под рукой гнет — деревянный круг и прижимала его чистым  тяжелым камнем.
  8. Чтобы образующиеся при закваске газы не скапливались в капусте, ее нужно проткнуть в нескольких местах деревянной палочкой.
  9. Для хранения квашеной капусты идеальная температура от 0 до +2 градусов. Можно переложить капусту в 3-литровые банки и тогда будет удобно ее хранить в холодильнике.
  10. Отлично сохраняется капуста в течение 9 месяцев. Правда, чем дольше она хранится, тем кислее становится. Поэтому лучше готовить все-таки небольшими порциями.
  11. Капуста сохраняет свои свойства только при однократной заморозке. Можете разложить квашеную капусту по пакетам и положить в морозильную камеру.
  12. Чтобы получилась вкусная хрустящая квашеная капуста, обратите внимание на фазу Луны. Лучше всего квасить капусту на растущей Луне, после Новолуния дня через 3-4.

Кислая квашеная капуста. Рисово-пшенная каша с квашеной капустой

Квашеная капуста . Квашеная капуста – незаменимый продукт зимнего меню. Хрустящая, кисленькая квашеная капуста с добавлением брусники, лаврового листа или яблок всегда уйдет на «ура» и под любой «аккомпанемент».
Квашеная капуста является признанным лидером по уровню витамина С. Самое удивительное, что этот витамин, который сравнительно быстро разрушается в других продуктах, в квашеной капусте остается в том же содержании на протяжении полугода. Весомый довод включить ее в свой рацион, не правда ли?
Главный консервант при приготовлении квашеной капусты — молочная кислота, вспомогательный – поваренная соль.
Для закваски рекомендуется брать плотные кочанчики поздних белокочанных сортов минимум 800 граммов. Из сортов рекомендуются среднеспелые — можарская, каширка, ладожская, сабуровка, белорусская, слава алтайская, из позднеспелых – славянка, кубышка, ликуришка, московская поздняя, завадовская и другие.
Квасят капусту так. Снимают верхние листья, шинкуют соломкой с помощью шинковки или ножа. Крупно натирают морковь. Солят и перетирают руками до получения сока, затем утрамбовывают в эмалированные кастрюли или обычные большие банки. Сверху накрывают марлей и ставят сверху гнет. Оставляют в теплом месте до появления на поверхности пены. Пену снимают, делают несколько проколов, перемешивают. Капуста бродит неделю, после чего ее ставят в темное прохладное место.
В капусту можно добавлять тыкву, перец, помидоры, кабачок, чеснок. Овощи ошпаривают кипятком, укладывают слоями, заливают рассолом и оставляют бродить. Капусту хранят в холодильнике или погребе.
Рецептов квашеной капусты очень много. Основной принцип таков – нарезать капусту и дождаться, пока она пустит сок. Срок зависит, в первую очередь, от добавок. А их может быть очень много – и калина, и хрена, и свекольный маринад, и с чем только ни смешивают капусту. Пробуйте и выбирайте на свой вкус!

Ошибки при квашении капусты. Неудачи при квашении капусты: 6 ошибок, которые допускает каждая вторая хозяйка

Какие щи без кислой капусты? Кажется, что приготовить главный ингредиент любимого первого блюда проще простого. Однако при квашении хозяйки иногда допускают ошибки, которые могут значительно изменить вкус капусты и укоротить срок ее хранения.

Зная главные ошибки, допускаемые при квашении капусты, вы никогда их не совершите

Только правильно заквашенная капуста до самой весны сохраняет все свои полезные свойства и витамины. Для приготовления лучше всего взять старую добрую белокочанную капусту. Краснокочанные разновидности после заквашивания могут иметь легкий горьковатый привкус.

Самые распространенные ошибки  при квашении капусты

1.

Передержали при комнатной температуре

Для заквашивания достаточно трех-четырех дней при комнатной температуре (+22…+24°С), а дальше капусту следует перенести в прохладное или даже холодное место. Такая закуска особенно хороша, если хранится на морозе. Берете нужное количество, размораживаете – и наслаждаетесь ее замечательным вкусом!

2. При заквашивании не выпущены образующиеся газы

Слой капусты необходимо ежедневно протыкать на всю толщу спицей. А еще лучше вывалить все содержимое в тазик, перемешать руками и снова заложить в тару для дальнейшего квашения. Достаточно проделать эту процедуру один раз через 2-3 дня с момента заквашивания.

3. Не использовали гнет

Капусту нельзя заквашивать без гнета (как и грибы). Все содержимое емкости должно быть полностью погружено в рассол.

4. Не досыпали соли

Недостаток соли может вызвать неудачу. Для правильного заквашивания надо брать по одной столовой ложке поваренной соли (30 г) на каждый килограмм капусты.

5. Использовали йодированную соль

Нельзя использовать йодированную соль (не только для квашения капусты, но и для всех других заготовок)!

6. Заквасили позднюю капусту

Квашение поздних сортов, предназначенных для длительного хранения – очень распространенная ошибка. Такие кочаны потому и хранятся хорошо, что в них недостаточно сахаров. Точнее, они постепенно накапливаются при хранении. Поэтому позднюю капусту можно квасить с конца декабря, когда сахаров в ней достаточно для запуска процесса квашения, а не в сентябре-октябре. Поздние сорта имеют тяжелый плотный кочан с тонкими листьями.

Позднюю капусту заквашивают только в конце декабря, когда в кочанах накопится достаточное количество сахаров

Капуста, готовая для квашения в октябре, имеет рыхлый кочан с толстыми сочными листьями. В таких сортах содержится достаточное количество полисахаров. Правильные кочаны отлично заквашиваются сразу после уборки.

Квашеная капуста с мясом рецепт с фото на Webspoon.

ru

Рецепт кислой капусты с мясом

Этот рецепт квашеной капусты с мясом был коронным блюдом моей бабушки по линии отца. Я до сих пор люблю это блюдо холодным, особенно летом. Его можно готовить только с мясом или добавлять крупно порезанный картофель. А бюджетный вариант — только картофель, без мяса.

Это очень вкусное и простое блюдо, с лёгкой кислинкой за счёт капусты, но оно и сытное. В западных регионах Украины к квашеной капусте с мясом подаются ещё и кнедлики, приготовленные на пару. Но о них позже!

Как приготовить «Квашеная капуста с мясом» пошагово с фото в домашних условиях

Шаг 1
Ссылка

Для приготовления квашеной капусты с мясом возьмём говядину, квашеную капусту, лук, морковь, томатную пасту, лавровый лист, соль и перец по вкусу, подсолнечное масло для жарки.

Шаг 2
Ссылка

Лук измельчаем, морковь натираем на крупной тёрке.

Шаг 3
Ссылка

На сковороду выливаем подсолнечное масло и обжариваем говядину до золотистой корочки.

Шаг 4
Ссылка

Добавляем лук и обжариваем до золотого цвета.

Шаг 5
Ссылка

Добавляем морковь и так же немножко обжариваем.

Шаг 6
Ссылка

Затем добавляем квашеную капусту (если она кислая, то предварительно промыть под проточной водой), лавровый лист, томатную пасту и перемешать.

Шаг 7
Ссылка

Залить водой и тушить до полной готовности мяса.

Шаг 8
Ссылка

Жидкость при этом должна практически вся испариться.

Шаг 9
Ссылка

Подавать можно как самостоятельное блюдо и как гарнир, например, к картофельному пюре.
Приятного аппетита!

Тушеная квашеная капуста.

Пошаговый рецепт с фото

Тушеная квашеная капуста может выступать как полноценным вторым овощным блюдом, так и быть основой начинки для домашней выпечки. С ней получаются вкусные пироги, пирожки, кулебяки, вареники и запеканки. Квашеная капуста, заправленная подсолнечным маслом и луком, вкусна сама по себе, но в том случае, если она приелась, попробуйте ее потушить. К тому же рецептов тушеной квашеной капусты достаточно много и можно каждый раз готовить ее по-другому.

Вкусной получается тушеная капуста с мясом, фасолью, ананасами, солеными огурцами, черносливом, фаршем, грибами, сосисками, свежей белокочанной капустой, болгарским перцем, помидорами. Во многих странах мира квашеная капуста входит в состав традиционных национальных блюд.

К ним можно с уверенностью отнести бигус, немецкая рулька в пиве с квашеной капустой, гуляш с квашеной капустой, щи из квашеной капусты, солянка. Этот список можно продолжать до бесконечности. Недавно я уже показывала, как приготовить тушеную квашеную капусту с мясом, сегодня же хочу предложить вам простой постный рецепт тушеной квашеной капусты с луком и морковью.

А сейчас давайте посмотрим, как готовится тушеная квашеная капуста – пошаговый рецепт с фото.

Ингредиенты:

  • Квашеная капуста — 400 гр., 
  • Томатный соус — 2 ст. ложки, 
  • Репчатый лук — 1 шт., 
  • Морковь — 1 шт., 
  • Специи: паприка, черный молотый перец, тмин.
  • Сахар — 1 ч. ложка, 
  • Соль — по вкусу, 
  • Лавровый лист — 1-2 шт., 
  • Подсолнечное масло

Тушеная квашеная капуста – рецепт

После того как все ингредиенты будут подготовлены, можно начать приготовление тушеной квашеной капусты. Если квашеная капуста, которую вы используете для тушения очень кислая, то перед тушением выложите ее в миску. Залейте холодной водой и подержите нам около 10 минут, после чего откиньте на дуршлаг, прижимая руками, дайте воде стечь. Для тушения квашеной капусты из овощей нам понадобится лук и морковь. Способ нарезки лука для тушения капусты классический – мелкими кубиками.

Морковку очищенную от кожуры необходимо натереть на мелкой терке.

В сковороду или сотейник налейте немного подсолнечного масла. Разогрейте ее. Выложите лук и морковь.

Овощи перемешайте и потушите до мягкости на небольшом огне 5 минут.

Квашеную капусты выложите в сковороду к тушеной морковь и луком.

Перемешайте ее с овощами.

Чтобы тушеная квашеная капута получилась ароматной, добавьте лавровый лист и специи.

А для выравнивания кислого вкуса капусты добавьте немного сахара. Что касается соли, то ее можно как добавлять, так и нет.

Снова перемешайте капусту. Для красивого насыщенного цвета добавьте в сковороду с тушеной квашеной капустой кетчуп или томатный соус.

Влейте полстакана воды, этого количества жидкости вполне достаточно, чтобы капуста смогла тушиться. Тушите квашеную капусту еще 15 минут. В процессе тушения не забывайте ее перемешивать, чтобы она не подгорела. Если хотите получить более мягкую и поджаристую капусту, потушите ее дольше.

Приятного вам аппетита. Буду рада, если этот рецепт тушеной квашеной капусты вам понравится. Рекомендую приготовить также и тушеную капусту с черносливом.

Тушеная квашеная капуста. Фото

 

Квашеная капуста за 3 дня — пошаговый рецепт с фото

Приготовление квашеной капусты за 3 дня:

1Подготовим ингредиенты.

Еще в магазине или на рынке необходимо при выборе капусты для засолки руководствоваться одним важным правилом: кочан нужно взять тот, который по цвету белый. Потому как зеленоватая на вид капуста имеет жесткие листья и мало сока, что навредит вкусу готового блюда. С кочана снимаем верхние листья, далее его промываем в воде и немного просушиваем чистым кухонным полотенцем или салфеткой. Разрезаем головку капусты на 4 части. Удаляем из серединки кочерыжку, а оставшуюся часть нарезаем ножом или специальной шинковкой на средние кусочки. Можно, конечно, нарезать капусту очень мелко. Но этот фактор еще зависит от того, что вы собираетесь из нее готовить. Важно учитывать, что соломка готовой капусты еще в разы уменьшится в момент закваски, так как из волокон будет выходить жидкость под действием соли.

Морковь необходимо очистить от кожуры, тщательно промыть в воде и измельчить на крупной терке.


2Заквасим капусту.

В миске необходимо тщательно размять руками капусту, постепенно добавляя в нее морковь. Для этого сжимаем ее в руках до тех пор, пока нашинкованная соломка немного не пустит сок, а вся морковь не будет смешана с капустой.

Когда эти действия выполнены, необходимо заложить получившуюся смесь в банку очень плотно. Желательно, даже немного приминать или утрамбовывать ее рукой или ступкой. Далее сверху засыпаем поваренную соль, но не размешиваем. После этого нам потребуется 1.5 литра холодной кипяченой воды, которую мы заливаем в нашу банку. Вода должна полностью покрывать капусту, поэтому если ее не хватило, необходимо немного добавить еще.


3Процесс засолки.

Банку обязательно кладем в миску, так как в период засолки из нее будет переливаться сок, а саму банку накрываем марлей или крышкой, но не плотно. В период закваски капусту кладем в теплое место. Это может быть и комнатная температура, то есть капусту в банке вы можете поставить в любое удобное место вашей кухни. Сам процесс будет длиться 3 дня. За это время из емкости то и дело будет выливаться сок, но так и нужно. Это будет означать, что вы все сделали правильно. Как правило, через три дня этот сок перестанет выливаться, а это означает, что квашеная капуста готова.


4Подаем квашеную капусту за 3 дня.

Из готовой капусты сливаем сок, добавляем в него сахар, когда он растворится, вновь заливаем его в капусту, плотно закрываем и ставим на хранение в холодильник. По необходимости достаем нужное количество, отжимает от рассола, и используем как закуску или в приготовлении пищи. Если капуста для определенного блюда сильно солена, то ее можно промыть в холодной проточной воде при помощи дуршлага. В этом случае соленый вкус капусты значительно ослабеет.
Приятного Вам аппетита!


Советы к рецепту

– — Самая простая, быстрая и вкусная закуска из квашеной капусты готовится следующим образом: нарезается полукольцами репчатый лук, добавляется в капусту и все это обильно заливается подсолнечным или оливковым маслом.

– — Квашеная капуста может храниться в таком виде в холодильнике в рассоле больше месяца.

– — В период засолки ежедневно необходимо протыкать капусту по всей длине длинным чистым предметом. Например, это может быть ручка от половника. Эта мера необходима для того, чтобы сок вновь мог попасть на самое дно банки.

как приготовить квашеная капуста с яблоками и морковью

Квашеная капуста с яблоками и морковью

капуста квашеная быстрого приготовления

Что нам понадобится:

2,5 кг капусты
350 г морковки
4 яблока
70 г сахара
70 г соли
5 лавровых листов
черный перец горошком (примерно 18-20 шт.)

Квашеная капуста с яблоками и морковью: как готовить

1. Приготовление квашеной капусты на зиму начинается с мелких заготовок, к которым нужно быть особо внимательным. Сперва нужно помыть морковку и капусту. Морковь натереть на крупной терке. Капусту нашинковать, стараясь сделать это как можно мельче.
2. Насыпать в посудину морковь и капусту, добавить соль, сахар и хорошо перемешать руками. Когда капуста и морковь пустят сок, добавить перец и лавровый лист.
3. Помыть яблоки, очистить от шкурки, затем порезать их кубиками или же натереть на крупной терке. Добавить яблоки к капусте с морковкой. Есть еще один способ сделать квашенную капусту – добавлять яблоки слоями в банку, по мере ее заполнения.
4. Взять чистую трехлитровую банку, наполнить ее квашенной капустой с яблоками и морковью, оставив примерно четыре сантиметра до горлышка.
5. Подготовить большую глубокую миску, поставить туда трехлитровую банку с квашенной капустой, прикрыв ее крышкой. Оставить квашеную капусту в банке на три дня при комнатной температуре. Важно каждый день (по несколько раз) протыкать квашенную капусту чистой деревянной палочкой или шпажкой. Это делают для того, чтобы выходили газы, образовывающиеся при брожении.
6. Через три дня вынести квашенную капусту с яблоками и морковью на балкон (или другое прохладное место) – пусть постоит там три-четыре дня. Обязательно нужно продолжать протыкать ее шпажкой.
7. Примерно за неделю квашенная капуста на зиму будет готова, и ее можно будет переместить в холодильник.

Подавая квашенную капусту с яблоками и морковью на стол, к ней можно добавить немного растительного масла.

Напомним, что у нас на сайте есть классический рецепт вкусного салата Цезарь.

Солянка из квашеной капусты, пошаговый рецепт с фотографиями – русская кухня: основные блюда. «Еда»




Белокочанная капуста


1 кг




Свежие грибы


500 г




Морковь


1 штука




Растительное масло


80 мл




Томатная паста


3 столовые ложки




Вода


125 мл




Сахар


1 чайная ложка




Молотый кориандр


½ чайной ложки




Петрушка


3 веточки




Укроп


3 веточки




Репчатый лук


1 головка




Лавровый лист


1 штука




Соль


по вкусу




Молотый черный перец


по вкусу

Квашеная капуста — обзор | Темы ScienceDirect

27.

3.5.1 Квашеная капуста

Квашеная капуста очень популярна во многих европейских странах благодаря своим сенсорным свойствам и высокой пищевой ценности. Процесс ферментации можно проводить самопроизвольно или путем добавления заквасок (контролируемая ферментация). Среди микроорганизмов, способствующих производству квашеной капусты, особое значение имеют Leuconostoc mesenteroides , Lactobacillus plantarum , Lactobacillus brevis, Pediococcus, и Enterococccus .

На содержание БА в квашеной капусте сильно влияют вид капусты, условия ферментации (температура, изменение значения pH, доступ кислорода или содержание хлорида натрия), микробные закваски, используемые для ферментации, и бактериальное загрязнение. Основными аминами, обнаруженными в квашеной капусте, являются Put, Him, Tym и Cad, тогда как Spm и Spd присутствуют только в небольших количествах (Kalac et al., 2000a, 2000b; Spicka et al., 2002).

Kalac et al. (1999) протестировали более 120 продуктов из квашеной капусты от чешских и австрийских производителей, и концентрации БА сильно различались (Put 2.8–529,0 мг / кг, Cad 0–293,0 мг / кг, Tym 0–37,5 мг / кг, Spd 0–47,0 мг / кг, Him 0–229,0 мг / кг). В спонтанно ферментированной квашеной капусте Tym (85–578 мг / кг) присутствовал на самом высоком уровне после 12 месяцев хранения, за ним следуют Put (10–233 мг / кг) и Cad (2–31 мг / кг). Концентрации Spd были ниже 14 мг / кг (Kalac et al., 2000a). Высокий уровень Put (265–446 мг / кг), Tym (85–212 мг / кг) и Cad (60–122 мг / кг) в контрольных вариантах квашеной капусты значительно подавлялся Lactobacillus plantarum и Microsil (Kalac и другие., 2000б). Накопление БА в спонтанно ферментированной китайской квашеной капусте показало концентрации Put (24–45 мг / кг), Cad (10–35 мг / кг) и Tym (30–38 мг / кг), которые увеличивались со временем ферментации. Однако в квашеной капусте, инокулированной L. plantarum и Zygosaccharomyces rouxii , содержание БА значительно снизилось (Wu et al. , 2014).

Брожение квашеной капусты

Брожение квашеной капусты почти не требует работы со стороны оператора. В капусте содержится достаточно молочнокислых бактерий для ферментации и производства квашеной капусты только с солью.Чтобы получить продукт высочайшего качества, все эти штаммы бактерий должны ферментироваться в определенной последовательности. Это происходит естественным образом, пока квашеная капуста ферментируется при температуре около 18 ° C (65 ° F).

  1. Leuconostoc mesenteroides — они самые маленькие и сначала начинают ферментацию, производя от 0,25 до 0,3% молочной кислоты. Они являются гетероферментерами, это означает, что они производят различные соединения, такие как молочная кислота, уксусная кислота (уксус), этиловый спирт, диоксид углерода (содовый газ) и маннит.Последний представляет собой соединение с горьким вкусом, которое позже метаболизируется Lactobacillus plantarum . Все эти кислоты в сочетании со спиртом из ароматических сложных эфиров придают характерный вкус квашеной капусте высокого качества. Если температура выше 72 ° F (22 ° C), они могут не расти, и это ухудшит вкус квашеной капусты. Примерно через 2 дня Leuconostoc mesenteroides произведет 0,3% молочной кислоты, и эта повышенная кислотность ограничит ее рост.Тем не менее, производимые ферменты будут продолжать развивать аромат.
  2. Lactobacillus plantarum — этот штамм берет на себя производство молочной кислоты из Leuconostoc mesenteroides и продолжает ферментацию до достижения уровня кислотности от 1,5 до 2%. L. plantarum ферментируется при температуре выше 72 ° F (22 ° C) и может расти при более высоком уровне кислотности. Он также будет бродить при более низких температурах, хотя и гораздо медленнее. Lactobacillus plantarum — самый популярный штамм молочнокислых бактерий, ферментирующий квашеную капусту, соленые огурцы, сыр и даже мясо.Эта бактерия является гомоферментером, что означает, что она производит только одно соединение. Он потребляет сахар и производит молочную кислоту, которая придает кислый вкус сброженным продуктам. По окончании этого этапа квашеная капуста имеет приемлемое качество и ее можно подавать или консервировать. Если сахара осталось достаточно, ферментация будет продолжаться до тех пор, пока не будет исчерпан весь запас сахара.
  3. Lactobacillus pentoaceticus (L.brevis) — продолжайте ферментацию до достижения уровня кислотности 2,5 — 3%. Поскольку в капусте больше не остается сахара, брожение подходит к концу.

Брожение квашеной капусты.

Любое изменение вышеуказанных циклов производства молочной кислоты изменит вкус и качество квашеной капусты. Если добавлено необходимое количество соли и соблюдены рекомендуемые температуры, три штамма бактерий будут сбраживать капусту в правильной последовательности.

Влияние температуры брожения

Квашеная капуста высшего качества производится при температуре 65-72 ° F (18-22 ° C). Температура от 45,5 ° F (7,5 ° C) до 65 ° F (18 ° C) способствует росту и метаболизму л.mesenteroides . Температура выше 72 ° F (22 ° C) способствует росту видов Lactobacillus . Как правило, при более низких температурах получается квашеная капуста более высокого качества, хотя при температуре 45,5 ° F (7,5 ° C) бактерии растут так медленно, что для завершения брожения капусте может потребоваться 6 месяцев. Более высокие температуры дают квашеную капусту за 7-10 дней, но худшего качества. Это приводит к настолько быстрой ферментации, что некоторые виды молочнокислых бактерий вообще не растут, и внутри происходит меньше реакции, что приводит к менее сложному вкусу.

  • При температуре ниже 45,5 ° F (7,5 ° C) время ферментации составляет до 6 месяцев.
  • При температуре 65 ° F (18 ° C) время ферментации составляет 20 дней.
  • При 90-96 ° F (32-36 ° C) время ферментации составляет 10 дней.

Контроль бактерий

Квашеная капуста производится молочнокислыми бактериями, которые расщепляют сахар на молочную кислоту, двуокись углерода (CO2, содовый газ) и небольшое количество спирта. Поскольку капуста содержит воду, сахар и множество питательных веществ, она является идеальной средой для роста всех типов бактерий, некоторых из них мы стараемся избегать.Термическая обработка обязательно убьет нежелательные бактерии, но она также убьет нужные нам молочнокислые бактерии, поэтому этот метод здесь не применяется.

Кислотность свежей капусты

pH составляет около 7,0, что соответствует нейтральной точке шкалы кислотности. Это делает капусту идеальной пищей для микроорганизмов, поскольку она содержит воду, сахар, белки, минералы и все питательные вещества. Мы контролируем рост бактерий, используя следующие шаги:

  • Стирка.
  • Применение соли.
  • Удаление кислорода.

Стирка. Капуста находится в прямом контакте с почвой, содержащей все виды микроорганизмов. Большинство микроорганизмов присутствует на внешних зеленых листьях, которые обычно выбрасываются. Один грамм свежей капусты может содержать 250 000 бактерий, а во время хранения это число может вырасти до 1 000 000. Итак, первым делом нужно хорошо вымыть капусту, так как это удаляет множество микроорганизмов. Если будут добавлены такие ингредиенты, как яблоки или морковь, их также необходимо тщательно промыть.

Соль. Соль нужна по двум причинам:

  1. Чтобы удалить капустный сок и питательные вещества из каждой клетки и сделать их доступными в качестве пищи для молочнокислых бактерий. Бактерии не будут есть сухие листья капусты, однако они будут поглощать наполненный питательными веществами сок. Бактерии подобны губке, они не собирают сухое вещество, но всасывают все влажное.
  2. Для защиты от других бактерий. Умеренное количество соли не беспокоит бактерии квашеной капусты (молочная кислота), однако другие типы бактерий считают такие условия невыносимыми.

Поскольку молочнокислые бактерии начинают медленно вырабатывать молочную кислоту, это становится еще хуже для других типов бактерий, поскольку обычно бактерии ненавидят кислоту. Конечно, умеренное количество кислоты совсем не беспокоит молочнокислые бактерии. Эта комбинация соли и увеличивающегося количества кислоты подавляет рост других бактерий и делает квашеную капусту более стабильной по мере продвижения ферментации

Для получения квашеной капусты высокого качества соль применяется в количестве 2 — 2,5% по отношению к весу нарезанной капусты.Уменьшение уровня соли вызовет проблемы с качеством, снижение уровня ниже 1,5% приведет к сгниванию капусты. Бактерии порчи выживут при таком низком уровне соли, возьмут на себя процесс и испортят продукт.

Отсутствие кислорода. Когда контейнер упакован с капустой, все микроорганизмы начинают конкурировать за пищу. Соль подавляет некоторые из них, но многим другим, например, плесени, нужен кислород для выживания. Удаление кислорода осуществляется несколькими способами:

  • Тара тара твердая с нашинкованной капустой.
  • Нарезка капусты тоньше, это позволяет укладывать больше капусты и рассеивать больше воздуха.
  • Хранение капусты в рассоле (используя утяжелители).
  • Использование ферментированных кувшинов с водяным каналом или стеклянных банок с воздушным затвором.

Удаление кислорода предохраняет витамин С от окисления и потери его силы.

Ферментированная квашеная капуста имеет pH около 3,5 и может храниться в прохладных условиях в течение очень долгого времени, пока поддерживается этот уровень pH.

Подсказки

Капуста должна содержать до 3 штук.5% сахар. Чем слаще сырая капуста, тем лучше будет квашеная капуста.

Добавление менее 2% соли может привести к образованию мягкой или даже слизистой квашеной капусты. Добавление менее 1% приведет к получению квашеной капусты, которая будет мягкой и неприемлемой для коммерческого использования. Добавление более 3,5% соли может подавить рост молочнокислых бактерий.

Чем больше вырабатывается молочной кислоты, тем более кислой становится квашеная капуста. Существует предел производства молочной кислоты. Как только запас сахара истощается, молочнокислые бактерии перестают расти.Белая накипь на поверхности квашеной капусты вызвана дрожжами, и ее следует удалять ежедневно. Нет причин отказываться от квашеной капусты.

Можно использовать рассол от предыдущего брожения квашеной капусты в качестве закваски для нового производства. Это распространенный метод, используемый при производстве хлеба или даже салями (обратный отвал), когда часть сброженного продукта сохраняется для нового производства. По крайней мере теоретически он должен производить новую партию с теми же характеристиками, что и старая.

Если было добавлено больше сахара, ферментация будет продолжаться дольше и будет производиться больше молочной кислоты. Это приведет к повышенной кислотности и очень кислой капусте, что нежелательно. В конце концов уровень кислотности будет настолько высоким, что
молочнокислые бактерии не выживут.

Во время ферментации глюкоза (сахар) превращается примерно в 50% молочной кислоты, 25% уксусной кислоты и этилового спирта и 25% диоксида углерода.

Поддерживайте температуру брожения ниже 80 ° F (27 ° C).Для получения сауэрктаута лучшего качества поддерживайте температуру брожения около 18 ° C (65 ° F).

Пузырьки — признак продолжающегося брожения. В стеклянной банке они поднимаются вверх.

Пузырьки брожения квашеной капусты.

Доступно на Amazon

Make Sausages Great Again упаковывает невероятное количество колбасы, превращая знания всего на 160 страниц. Подробно описаны правила, советы, стандарты, виды колбас, способы копчения и многие другие темы. Также в нем 65 популярных рецептов. Официальные стандарты и профессиональные методы обработки используются, чтобы объяснить, как создавать новые рецепты и производить любые виды качественной колбасы в домашних условиях.

Квашеная капуста: бактерии, из которых состоит еда — Сеть блогов Scientific American

На прошлой неделе моему мужу понадобились несколько банок для приготовления пищи. Tesco продает баночки где-то по 3 фунта за штуку. Однако они также продают большие банки квашеной капусты по 1 фунт каждая. Это означает, что на прошлых выходных у нас было очень много квашеной капусты, которую нужно было попробовать.

Я не большой поклонник квашеной капусты, и очень жаль, потому что ее вкус в большей степени обусловлен действием бактерий. В процессе ферментации участвует не одна бактерия, а целый ряд различных видов. Бактерии даже не нужно добавлять в квашеную капусту, поскольку они естественным образом живут на капустных листьях. Все, что требуется для начала процесса, — это нашинкованная капуста и соль.

На первом этапе брожения квашеной капусты участвуют анаэробные бактерии, поэтому измельченную капусту с солью нужно упаковать в герметичный контейнер.На этом этапе окружающая среда не кислая, а просто капустная. Бактерии, в основном видов Leuconostoc , производят углекислый газ (заменяющий последние остатки кислорода в сосуде) и молочную кислоту, которая является естественным побочным продуктом анаэробного дыхания. В конце концов, условия в банке становятся слишком кислыми, чтобы эти бактерии могли выжить, и они вымирают, заменяясь бактериями, которые лучше справляются с кислыми условиями s , такими как Lactobacillus видов.

Лактобациллы дополнительно сбраживают любые сахара, оставшиеся в капусте, используя анаэробное дыхание. Это производит больше молочной кислоты, пока квашеная капуста не достигнет pH около 3. Эти бактерии подавляются высокими концентрациями соли (так что большая часть квашеной капусты содержит около 2-3% соли) и низкими температурами, поэтому банки для брожения следует оставить при комнатной температуре, а не в холодильнике. При ph4 l actobacillus прекращает брожение, и квашеную капусту можно хранить до тех пор, пока она не понадобится.

Все эти бактерии помогают создать острый кисловатый вкус, однако есть причины, по которым рост микробов может пойти не так. Чрезмерный рост лактобацилл , например, если банка хранится при слишком высокой температуре во время ферментации, может привести к тому, что квашеная капуста приобретет неправильную консистенцию. Точно так же, если квашеная капуста становится слишком кислой слишком рано, лактобациллы рано вступают в действие, что приводит к мягкой квашеной капусте. Хотя готовая квашеная капуста слишком кислая, чтобы в ней могли жить патогены, споры грибов могут оседать на поверхности и распространяться, портя пищу.

Хотя квашеная капуста — немецкое слово, считается, что это блюдо возникло в Китае из капусты, сброженной в рисовом вине или рассоле. Это распространилось в Европу через захватчиков Чингисхана, где капуста была засушена солью. Поскольку квашеная капуста хранится в течение длительного времени и является источником витамина С, голландские моряки предпочитали ее, когда отправлялись в Америку. Капитан Кук также путешествовал с ним в Австралию, поскольку квашеная капуста содержит ряд витаминов и минералов, которые трудно получить при длительном путешествии по морю.

Поскольку бактерии, необходимые для брожения квашеной капусты, содержатся на капустных листьях, приготовить это блюдо очень просто и полезно для здоровья. Все, что вам нужно, это капуста! Используя действие бактерий, можно использовать простые ингредиенты, такие как капуста и соленая вода, для приготовления полезного блюда, которое можно хранить намного дольше, чем когда сырые фрукты и овощи начнут портиться.

Приготовление и консервирование квашеной капусты | Ohioline

Чтобы приготовить квашеную капусту, измельченную капусту смешивают с солью и оставляют для брожения.Количество добавляемой соли имеет решающее значение для обеспечения безопасности пищевых продуктов, и его не следует регулировать. Брожение длится от трех до шести недель в зависимости от температуры воздуха. За это время кислотность в продукте повысится. После того, как квашеная капуста ферментируется, ее можно консервировать или замораживать.

Подходящие сорта капусты

Квашеная капуста может быть приготовлена ​​из всех сортов капусты; однако одни разновидности подходят лучше, чем другие. Обычно кочаны капусты, выращиваемые для переработки, намного больше, чем кочаны, выращенные для свежего рынка.Производителям квашеной капусты также рекомендуется попробовать новые сорта. Наиболее желательны зрелые головы весом от 6 до 15 фунтов с твердым белым внутренним слоем. Кроме того, капуста, собранная в конце сезона, также может содержать больше сахаров, которые будут поддерживать рост бактерий во время ферментации. Следует учитывать размер кочана (от малого до большого), форму (круглую, плоскую, коническую и вариации), плотность и цвет (зеленый, сине-зеленый или красный), а также текстуру листа (гладкий или савойский). Листы обертки (количество, толщина и плотность) и длина сердцевины также могут варьироваться в зависимости от сорта.

Разновидности, которые следует учитывать, включают:

Danish Ballhead — среднеспелый сорт семейной реликвии с приятным вкусом и текстурой

Premium Late Dutch — сорт позднего сезона с кочами от 10 до 15 фунтов, отлично подходит для использования осенью или зимой.

Каменная голова — очень ранняя, маленькая голова

Ранний плоский голландский — ранний, с круглой головкой

Head Start — кочан раннего среднего размера, отлично держит поле для раннего типа

Hinova — поздняя разновидность, плоские, закругленные головки

Red Acre — кочан 3 фунта, красный сорт

Состав и материалы

  • 25 фунтов свежей капусты
  • ¾ чашка консервной соли
  • Емкость для брожения

Сосуды для ферментации должны быть сделаны из камня, стекла или пищевого пластика. Подсчитайте, что контейнер объемом 1 галлон подойдет для 5 фунтов капусты. Горшки не должны иметь трещин или быть покрытыми металлом. Контейнеры из алюминия, меди, латуни, железа, оцинкованного металла или мусорные баки не подходят. Перед брожением емкости необходимо промыть теплой водой с мылом. Чистые контейнеры, изготовленные из непищевых материалов, можно использовать, если используется пищевой пластиковый вкладыш. Пакеты для мусора не являются пищевыми пластиковыми вкладышами.

Инструкции по приготовлению

Работая с 5 фунтами капусты за раз, выбросьте внешние листья и промойте холодной чистой водой для удаления почвы и мусора.Кочан нарезать кусочками и удалить сердцевину. Нарежьте на длинные тонкие полоски, толщиной примерно в четверть.

Смешайте 5 фунтов капусты и 3 столовые ложки консервной соли и хорошо перемешайте. Повторяйте этот процесс, пока не получите 25 фунтов капусты и? чашка консервной соли. Перелейте эту смесь в подходящий контейнер (см. Ниже). В верхней части контейнера должно оставаться от 4 до 5 дюймов свободного пространства. Капуста должна быть полностью покрыта жидкостью, поэтому, если сока из нашинкованной капусты недостаточно, чтобы покрыть капусту, сделайте соленый рассол, добавив 1 литр воды и 1½ столовых ложки консервной соли.Предпочтительнее использовать соль для маринования или консервирования, поскольку она не содержит йода и агентов, препятствующих слеживанию. Рассол следует прокипятить и охладить до комнатной температуры, прежде чем добавлять в капустную смесь.

Подходящие контейнеры: керамическая посуда, большая стеклянная банка или пищевой пластиковый контейнер. НЕ ИСПОЛЬЗУЙТЕ: мусорные баки, алюминиевые, медные, латунные, оцинкованные или железные контейнеры.

Взвешивайте капусту , чтобы она оставалась погруженной в жидкость. Можно использовать тяжелую тарелку или крышку, которая вставляется в емкость.Или используйте двойной слой пищевых пластиковых пакетов (например, повторно закрывающиеся пакеты для заморозки на галлон) и заполните верхний пакет рассолом для веса. Капусту следует залить рассолом на 1-2 дюйма. Защита капусты от кислорода поможет ограничить рост плесени во время брожения.

Ферментация

В процессе брожения храните квашеную капусту при температуре 70–75 градусов по Фаренгейту. При такой температуре ваша квашеная капуста полностью ферментируется примерно за 3-4 недели.При температуре 60-65 градусов по Фаренгейту процесс брожения может занять от 5 до 6 недель. Если температура выше 75 градусов по Фаренгейту, квашеная капуста может стать мягкой и не иметь вкуса. Если температура ниже 60 по Фаренгейту, ферментация может быть вялой и должная кислотность может быть не достигнута.

Во время ферментации молочнокислые бактерии (те же микробы, которые делают йогурт) могут расти в среде с высоким содержанием соли и производить кислоту и ароматизаторы, связанные с ферментированными овощами.Молочнокислые бактерии естественным образом встречаются на поверхности овощей, поэтому вам не нужно добавлять их в культуры, как это было бы с другими ферментированными продуктами. Добавляемая вами соль и кислота, вырабатываемая бактериями, помогут контролировать патогенное бактериальное заражение. Следовательно, нельзя снизить уровень соли в ферментированных овощных продуктах и ​​использовать заменители соли. Кислота, образующаяся во время ферментации, — это то, что сохраняет продукт.

Молочнокислые бактерии производят различные ароматные побочные продукты во время ферментации.Самым важным из них является молочная кислота, которая способствует терпкости и сохранности готового краута. Однако другие кислоты и ароматизаторы также производятся бактериями по мере их роста. Температура, при которой хранится квашеная капуста, влияет на развитие этих ароматов и молочной кислоты. При более низких температурах рост происходит медленнее. Поэтому процесс ферментации часто занимает больше времени при хранении в более прохладных условиях.

При использовании тяжелой тарелки, крышки или банок для утяжеления капусты необходимо проверять квашеную капусту два-три раза в неделю и удалять накипь, если она образуется.На поверхности ферментационного рассола может образоваться тонкая пленка дрожжей или плесени (накипь). При использовании мешка, заполненного рассолом, в качестве груза не трогайте емкость до тех пор, пока не завершится нормальная ферментация (когда прекратится выделение пузырьков) .

Методы консервирования: Нарезанную капусту необходимо взвесить, чтобы добавить необходимое количество соли для ферментации. После завершения брожения квашеную капусту можно консервировать, охлаждать или замораживать.

Консервирование из квашеной капусты

Сырье для упаковки путем наполнения банок квашеной капустой и покрытия соком, оставляя свободное пространство ½ дюйма. Протрите края банок; отрегулируйте крышки и обработайте на кипящей водяной бане. В таблице ниже указано время обработки, основанное на рекомендациях по высоте. Начните отсчет времени после того, как водяная баня снова закипит.

Горячие упаковки квашеную капусту, доведя ее и жидкость до кипения, часто помешивая. Снимите с огня, наполните банки, оставив ½-дюймовое свободное пространство, протрите края банок, отрегулируйте крышки и обработайте на бане с кипящей водой.В таблице ниже указано время обработки, основанное на рекомендациях по высоте. Начните отсчет времени после того, как водяная баня снова закипит.

Высота (футы) До 1000 До 3000 До 6000 Свыше 6000
Горячий пакет Пинты 10 минут 15 минут 15 минут 20 минут
кварт 15 минут 20 минут 20 минут 25 минут
Raw Pack Пинты 20 минут 25 минут 30 минут 35 минут
кварт 25 минут 30 минут 35 минут 40 минут

Заморозьте , заполнив пакеты для замораживания объемом пинты или кварты или многоразовые пластиковые контейнеры для замораживания с гребнем и оставьте не менее 3 дюймов для расширения во время замораживания. Выдавить воздух, запечатать и наклеить этикетку. Заморозьте от восьми до 12 месяцев.

Ссылки

Андресс, Э., Уильямс, П., Харрисон, Дж., И Рейнольдс, Дж. Так легко сохранить. Афины: Совместные консультационные службы, Университет Джорджии, Колледж семейных и потребительских наук, Колледж сельскохозяйственных и экологических наук, 2014.

Гарден-Робинсон, Дж. И Р. Смит. Квашеная капуста: от огорода к столу ; ФН-433; www.ag.ndsu.edu/pubs/yf/foods/fn433.pdf. Фарго, Северная Дакота: Государственный университет Северной Дакоты, 2011.

Министерство сельского хозяйства США. Полное руководство по домашнему консервированию, Информационный бюллетень по сельскому хозяйству № 539 . 2009.

Анализ микробного сообщества квашеной капусты показывает стабильное и быстро установившееся сообщество

Foods. 2018 Май; 7 (5): 77.

Оба автора внесли одинаковый вклад.

Поступило 10.04.2018 г .; Принято 10 мая 2018 г..

Лицензиат MDPI, Базель, Швейцария.Эта статья — статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution (CC BY) (http://creativecommons.org/licenses/by/4.0/). Эта статья цитировалась другими статьями в PMC. .

Abstract

Несмотря на недавний интерес к микробным сообществам ферментированных продуктов, было мало исследований динамики бактериального сообщества квашеной капусты, одного из старейших и наиболее распространенных ферментированных продуктов в мире. В этом исследовании мы используем секвенирование ампликона 16S рРНК для профилирования микробного сообщества естественно ферментированной квашеной капусты на протяжении всего процесса ферментации, а также анализируем бактериальные сообщества исходных ингредиентов и производственной среды.Наши результаты показывают, что микробиом квашеной капусты быстро устанавливается после начала ферментации и что сообщество остается стабильным благодаря ферментации и упаковке для коммерческой продажи. Наш высокопроизводительный анализ согласуется с предыдущими исследованиями, в которых использовались традиционные микробиологические оценки, но расширяет выявленную таксономию. Кроме того, мы обнаружили, что микробные сообщества исходных ингредиентов и производственная среда демонстрируют низкую относительную численность молочнокислых бактерий, которые преобладают в ферментированной квашеной капусте.

Ключевые слова: квашеная капуста, микробиом, ферментация, пробиотики, высокопроизводительное секвенирование

1. Введение

Квашеная капуста, ферментированный продукт, приготовленный в основном из капусты, является одним из самых известных разновидностей ферментированных продуктов питания, начиная с давних времен в Римскую империю. Исторически сложилось так, что она служила источником питательных веществ в зимние месяцы, когда свежих продуктов было мало, поскольку правильная ферментация сохраняет питательную ценность капусты, создавая желаемые сенсорные свойства [1,2].Он чаще всего ассоциируется с культурами Центральной и Восточной Европы, хотя его можно найти и в западноевропейской кухне. Считается, что квашеная капуста является частью американского рациона с момента основания страны, обычно в качестве ингредиента для приготовления пищи, гарнира или приправы. Его популярность снизилась с 1930-х годов в результате изменения потребительских предпочтений и отсутствия единообразия продукта [1,3]; тем не менее, достижения в области науки о ферментации пищевых продуктов и современные интересы потребителей вернули квашеную капусту популярность в последние годы.Сегодня в Соединенных Штатах широко продаются как массовые, так и кустарные приготовления квашеной капусты.

Производство и характеристики квашеной капусты в значительной степени зависят от местного микробного сообщества и условий ферментации [4]. Хотя микробный состав квашеной капусты может изменяться на начальных этапах ферментации, соответствующие условия ферментации, такие как температура и относительная концентрация ингредиентов, гарантируют, что молочнокислые бактерии (LAB) являются доминирующими микроорганизмами в конечном ферментированном продукте. Эти LAB имеют решающее значение для успешной ферментации; они производят органические кислоты, бактериоцины, витамины и ароматизирующие соединения, ответственные за многие характерные сенсорные качества ферментированных пищевых продуктов, включая увеличенный срок хранения, вкус и питательную ценность [5,6,7,8]. Кроме того, предполагается, что некоторые LAB действуют как пробиотики, которые способствуют здоровью человека и стабильности микробиома [9,10]. Хотя эти утверждения еще не были полностью подтверждены учеными, такая точка зрения способствовала недавнему росту потребительской популярности и потребления в Соединенных Штатах [11].

Каноническая ферментация квашеной капусты начинается с первоначального распространения Leuconostoc mesenteroides , который быстро производит углекислый газ и кислоту. Это быстро снижает pH окружающей среды, подавляя рост нежелательных микроорганизмов, которые могут вызвать порчу пищевых продуктов, сохраняя при этом цвет капусты [12]. Действие L. mesenteroides изменяет среду ферментации, так что он способствует преемственности других LAB, таких как Lactobacillus brevis и Lactobacillus plantarum [12].При традиционном производстве квашеной капусты этот процесс продолжается при 18 ° C в течение примерно одного месяца [12]. Комбинация метаболитов, производимых этими организмами, приводит к появлению в конечном продукте благоприятных сенсорных качеств — уникальных вкусов, ароматов и текстур, связанных с ферментированными продуктами [12,13]. Температура ферментации также играет важную роль с точки зрения цвета, вкуса и сохранности [12].

Исторически важными видами квашеной капусты считались л.mesenteroides, L. plantarum и L. brevis , что подтверждается недавними исследованиями [12,14]. Считается, что в случае аномально высокой температуры или солености в процессе ферментации играют роль Enterococcus faecalis и Pediococcus cerevisiae [12]. Однако эти наблюдения были основаны на исследованиях, в которых для выделения бактерий использовались методы культивирования, которые по своей природе предвзяты из-за их неспособности улавливать ряд некультивируемых бактерий. Недавние исследования также определили, что род Weissella важен для ранних ферментативных процессов [14].

Последние достижения в технологии высокопроизводительного секвенирования создали потенциал для высокоточной, независимой от культуры характеристики микробиома квашеной капусты. Появление технологии секвенирования ампликона 16S рРНК позволило систематически анализировать микробиом квашеной капусты до, во время и после ферментации. Квашеная капуста, сброженная при более высоких температурах, исторически считается более низкого качества, чем квашеная капуста, сброженная при низких температурах; однако современные методы промышленного производства обращаются к ферментации при теплой температуре, поскольку она резко сокращает время производства.

Здесь мы анализируем таксономический состав квашеной капусты, сброженной при комнатной температуре в течение 14-дневного периода ферментации. В целом, таксономический состав этой квашеной капусты соответствует таксономическому составу, наблюдаемому в квашеной капусте, сброженной в традиционном диапазоне низких температур, что позволяет предположить, что ферментация при теплой температуре может быть жизнеспособным вариантом для производства квашеной капусты с соответствующей структурой бактериального сообщества. с квашеной капустой, полученной более традиционным холодным брожением.Это может представлять особый интерес для промышленных и коммерческих производителей, которые смогут ускорить свой производственный процесс, не жертвуя таксономическим составом, который лежит в основе интереса потребителей к пробиотикам и ферментированным продуктам питания.

2. Материалы и методы

2.1. Приготовление квашеной капусты и методы отбора проб

Квашеная капуста для данного исследования была взята из одной партии весом 50 фунтов, подготовленной для коммерческой продажи в июне 2017 года на предприятии, расположенном недалеко от Провиденса, Род-Айленд.Перед добавлением тмина (<1% по весу) капусту засалили до концентрации 2,25%. Образцы ингредиентов были собраны в трех экземплярах во время обычного производственного цикла; 0,5 г каждого ингредиента помещали в пробирки Эппендорфа объемом 1,5 мл, содержащие 500 мкл воды, свободной от нуклеаз. Партию квашеной капусты запечатали в герметичные пластиковые бочки на время брожения. Ферментация проводилась примерно при 21 ° C. Успешная ферментация определялась конечным pH ниже 3,6. Образцы ферментации собирали в трех экземплярах с помощью пипеток Пастера из сброженной квашеной капусты в дни 0, 2, 7, 10 и 14.Образцы не являются истинными биологическими копиями, поскольку все тройные копии были получены из одной и той же партии сброженной квашеной капусты; это ограничение нашего исследования, и будущие исследования должны изучить согласованность динамики микробиома между партиями. Упакованная квашеная капуста в банках от этого производителя была куплена у коммерческого дистрибьютора и обработана вместе с образцами ферментации для анализа микробиома готового продукта.

Для отбора проб производственной среды производственный стол, промышленная раковина и пол производственного помещения были трижды промыты флокированными стерильными тампонами; затем их хранили по отдельности в пробирках для лизиса ДНК / РНК Zymo Research (Zymo Research, Ирвин, Калифорния, США; кат.: R1103).Для отбора проб воздуха в помещении пустые чашки Петри оставляли открытыми по всему помещению на протяжении всего периода ферментации. На 14-й день с чашек Петри брали мазки, как описано выше. После сбора все образцы были немедленно доставлены в лабораторию на льду и хранили при -80 ° C до обработки.

2.2. Экстракция ДНК, подготовка библиотеки 16S и секвенирование

Образцы квашеной капусты, окружающей среды и ингредиентов были обработаны с использованием набора ZymoBIOMICS DNA Microprep Kit (Zymo Research, Irvine, CA, USA; Cat: D4305) в соответствии с инструкциями производителя для экстракции ДНК.Используя протокол Earth Microbiome Project 16S Illumina Amplicon, мы нацелены на гипервариабельную область V4 бактериального гена 16S рРНК с использованием обратного праймера 806Rb (GGACTACCAGGGTATCTAATCC) и прямого праймера 515F со штрих-кодом (CAGCAGCCGCGGTAAT) [15,16,17,18,18] . ПЦР-ампликоны были созданы с использованием полимеразы Phusion High-Fidelity (New England BioLabs, Ипсвич, Массачусетс, США) в следующих условиях: 98 ° C в течение 3 минут, затем 35 циклов при 98 ° C в течение 45 с, 50 ​​° C в течение 60 секунд. с и 72 ° C в течение 90 с, и заканчивая конечным удлинением при 72 ° C в течение 10 минут.Концентрации ампликона

для ПЦР анализировали с использованием флуориметра Qubit 3.0 и набора dsDNA-HS (Thermo Fisher Scientific, Waltham, MA, USA) в соответствии с инструкциями производителя. Равные количества ампликонов из каждого образца объединяли, концентрировали и очищали в геле с использованием набора Machery-Nagel NucleoSpin и PCR Clean-Up (Machery-Nagel, Düren, Германия, Cat: 740609) в соответствии с инструкциями производителя. Объединенные образцы были отправлены в Центр геномики и секвенирования Род-Айленда при Университете Род-Айленда (Кингстон, Род-Айленд, США) для контроля качества и секвенирования.Ампликоны секвенировали по парным концам (2 × 250 п.н.) на платформе Illumina MiSeq с использованием набора на 500 циклов со стандартными протоколами.

2.3. Анализ разреженности и секвенирования

Необработанные показания FASTQ с парных концов были демультиплексированы с помощью idemp (https://github.com/yhwu/idemp/blob/master/idemp.cp) и импортированы в программу Quantitative Insights Into Microbial Ecology 2 ( QIIME2, версия 2017.9.0, https://qiime2.org/). Необработанные считывания были впоследствии депонированы в базу данных архива считывания последовательностей (SRA) Национального центра биотехнологической информации (NCBI) под регистрационным номером SRA SRP145097.Алгоритм устранения шумов 2 Divisive Amplicon (DADA2) использовался для качественной фильтрации, обрезки, устранения шума и объединения данных. Химерные последовательности удаляли методом консенсуса. Классификатор объектов в QIIME2, обученный с помощью базы данных операционных таксономических единиц (OTU) SILVA 99% и обрезанный до области V4 16S, был использован для присвоения таксономии всем вариантам рибосомной последовательности. Загрязняющие последовательности митохондрий и хлоропластов были отфильтрованы из полученной таблицы признаков. Остальные репрезентативные последовательности были выровнены с помощью MAFFT и использованы для филогенетической реконструкции в FastTree.Наконец, показатели разнообразия были рассчитаны с использованием плагина разнообразия QIIME2 и визуализированы с помощью Prism (версия 7.0a, GraphPad, Ла-Хойя, Калифорния, США).

После качественной фильтрации и предварительной обработки мы определили, что 8 из наших 37 секвенированных образцов имели менее 650 считываний, что мы сочли недостаточным для статистически мощного анализа разнообразия и, следовательно, потенциальным источником систематической ошибки. Поэтому мы удалили эти образцы с плохим чтением из последующего анализа альфа- и бета-разнообразия. Пять отброшенных образцов были распределены по разным типам ингредиентов и образцов окружающей среды.Учитывая низкую вариацию между двумя оставшимися повторами в этих типах образцов, мы считаем, что двух повторов достаточно для публикации. Три других образца с плохим считыванием были троекратными образцами ферментации, начиная с дня 0. В этих образцах преобладали контаминирующие считывания хлоропластов, которые были удалены с помощью вычислений. Остальные бактериальные считывания были достаточно низкими, что представляло проблему для измерений альфа- и бета-разнообразия. Низкое количество считываний бактерий в образцах дня 0 и других наших образцах, вероятно, является отражением изначально низкой численности бактерий в этих сообществах.Хотя это и ограничивает потенциальные возможности наших выводов, это неизбежный результат работы с сообществами с низкой численностью. Это отражается в отсутствии Дня 0 в и. Чтобы визуализировать бактериальное сообщество в момент времени 0 дня, мы использовали менее строгий предел для включения образца в гистограммы наших таксонов — 250 показаний (). Это позволило нам повторно захватить все три повтора из дня 0 и получить представление о структуре этих сообществ в отсутствие анализа разнообразия.

Показатели альфа-разнообразия образцов квашеной капусты, ингредиентов и окружающей среды.( A ) индекс Шеннона; и ( B ) Филогенетическое разнообразие Фэйтс. Планки погрешностей представляют собой стандартную ошибку среднего.

PCoA, отображающее невзвешенное расстояние UniFrac между образцами квашеной капусты, окружающей средой и микробиомом ингредиентов.

Относительное обилие бактериальных таксонов в ферментирующей квашеной капусте, ингредиентах и ​​образцах окружающей среды на уровнях порядка ( A ) и ( B ) рода. Показаны только семь верхних таксонов из групп образцов ферментации и ингредиентов / окружающей среды.

3. Результаты

Значения альфа-разнообразия окружающей среды, ингредиентов и квашеной капусты были измерены с помощью индекса разнообразия Шеннона и филогенетического разнообразия Фэйт. Эти значения показывают снижение бактериального разнообразия для ферментации квашеной капусты по сравнению с исходными ингредиентами и окружающей средой (). Однако мы наблюдаем контрастирующие паттерны альфа-разнообразия между показателями разнообразия Шеннона и филогенетического разнообразия Веры в процессе ферментации.Индекс разнообразия Шеннона указывает на последовательное увеличение альфа-разнообразия квашеной капусты с течением времени, в то время как филогенетическое разнообразие Фейт предполагает постоянное низкое альфа-разнообразие. Мы связываем это с тем, что сегменты индекса разнообразия Шеннона тесно связаны и, возможно, перекрывают LAB в отдельные таксоны. Это создает ложную видимость разнообразия. Напротив, индекс филогенетического разнообразия Faith использует длину ветвей в качестве основы для присвоения показателей разнообразия и не разделяет LAB с одинаковым уровнем детализации.Тем не менее, низкий уровень разнообразия продукта ферментации, показанный на обоих графиках, вероятно, является результатом селективного давления в среде ферментации, включая низкий pH, анаэробные условия и высокую соленость. Это свидетельствует об успешном брожении.

Затем мы использовали анализ основных координат (PCoA) с невзвешенным расстоянием UniFrac, чтобы визуализировать различия в структурах сообществ между нашими выборками (). Образцы демонстрировали четкую кластеризацию по типу образца — сырой ингредиент, среда или момент времени ферментации, что указывало на то, что присутствующие бактериальные сообщества значительно отличаются друг от друга.Это ожидается для образцов окружающей среды по сравнению с исходными ингредиентами или моментами времени ферментации, но было неожиданным для исходных ингредиентов по сравнению с ферментирующей квашеной капустой. Образец дня 0, полученный из исходной смеси ингредиентов, намного больше похож на сообщество квашеной капусты 14 дня, чем на сырые ингредиенты (). Это говорит о том, что давление отбора, присущее ферментации, оказывает сильное и немедленное воздействие на бактерии, обнаруженные в сырых ингредиентах.

Чтобы дополнительно охарактеризовать бактериальное сообщество, обнаруженное в каждом из собранных образцов, мы исследовали таксономические структуры наших бактериальных сообществ на уровне порядка и рода ().На уровне заказа мы видим различия в бактериальном составе между образцами сырых ингредиентов, образцами окружающей среды и образцами ферментации (A). Категории сырых ингредиентов и экологических объектов довольно похожи друг на друга. Морская соль немного отличается от капусты и тмина, что может быть связано с тем, что соль не является растительным продуктом и, вероятно, оказывает сильное галофильное давление отбора. В целом эти две категории образцов заметно отличаются от бактериальных сообществ, обнаруженных во время ферментации.Образец дня 0 содержит значительно больше бактериальных таксонов, чем образцы последующих временных точек, и демонстрирует резкое падение количества видов бактерий, присутствующих в течение первых 48 часов ферментации. Наиболее многочисленным отрядом бактерий в образце ферментации в день 0 является Pseudomonadales, который также является одним из наиболее распространенных видов во всех образцах окружающей среды. Это говорит о том, что окружающая среда играет некоторую роль в создании первоначального бактериального сообщества комбинированных ингредиентов.Через два дня наиболее многочисленными присутствующими бактериями являются Lactobacillales, что ожидается в случае успешной ферментации. Этот образец сохраняется во время брожения и сотрясения.

На уровне родов мы обнаруживаем, что сохраняются многие из тех же тенденций (B). Три образца ингредиентов выглядят наиболее схожими на этом уровне: Halomonas являются общими и преобладающими во всех трех образцах. Образцы окружающей среды продолжают демонстрировать сходство, и отсутствие сходства между образцами окружающей среды и образцами ферментации дня 0 сохраняется здесь, как и на уровне заказа.LAB доминируют над другими образцами ферментации, как и на уровне заказа, с Leuconostoc и Lactobacillus в качестве доминирующих родов. Это соответствует результатам, опубликованным Pederson и Albury 1969, которые показали, что Leuconostoc и Lactobacillus являются основными участниками процесса ферментации квашеной капусты [12].

4. Обсуждение

В целом, наши результаты показывают, что, несмотря на более теплый и быстрый процесс ферментации, используемый для производства квашеной капусты, анализируемой здесь, бактериальное сообщество соответствует таковому в более традиционных, более холодных продуктах из квашеной капусты.В течение первых 48 часов ферментации микробное сообщество квашеной капусты испытало резкое падение количества присутствующих бактериальных таксонов, вероятно, из-за сильного селективного давления высокой солености и кислотности в среде ферментации. В течение оставшейся части периода ферментации LAB оставались доминирующими организмами, присутствующими в сообществе. Оба образца свидетельствуют об успешном брожении.

Возможно, более удивительной была взаимосвязь между микробными сообществами исходных ингредиентов, средой ферментации и ферментирующей квашеной капустой. Основные LAB, обнаруженные в ферментирующей квашеной капусте, присутствовали только в очень низких количествах в исходных ингредиентах, что может свидетельствовать о том, что для инициирования ферментации необходимы только следовые количества LAB. Также возможно, что обилие LAB ферментативной квашеной капусты, обнаруженное вокруг производственного объекта, особенно в воздухе, может способствовать возникновению ферментативного сообщества, выступающего в качестве закваски. Присутствие LAB в окружающей среде также может быть прямым результатом ферментации квашеной капусты в ней.Эти гипотезы требуют дальнейшего изучения.

В предыдущих исследованиях использовались методы, основанные на культивировании и секвенировании, для выяснения сообщества ферментативных микробов квашеной капусты. Методы, основанные на культуре, показали, что основными LAB, участвующими в ферментации квашеной капусты, являются E. faecalis , L. mesenteroides , L. brevis , P. cerevisiae и L. plantarum; , тогда как методы, основанные на секвенировании, выделяют Lactobacillus и Leuconostoc в дополнение к Weissella [11,13].Наши результаты с использованием секвенирования 16S рРНК совпали с этими ожиданиями и расширили предыдущие знания, выявив Leuconostoc, Lactobacillus и Enterobacteriaceae в дополнение к множеству ранее не обнаруженных LAB, таких как Lactococcus .

Наши результаты также соответствуют каноническим микробным сообществам других ферментированных овощных продуктов. Xiong et al. обнаружили, что виды Lactobacillus и Leuconostoc были основными бактериями в ферментации китайской квашеной капусты, pàocài [20].Многочисленные исследования показали, что в бактериальном сообществе кимчи доминируют видов Weisella, Lactobacillus, и Leuconostoc [21,22,23]. Исследование традиционных вьетнамских ферментированных овощей, таких как горчица и свекла ( dua muoi ) и ферментированные баклажаны ( cà muối ), обнаружило преобладание в ферментации видов Lactobacillus [24].

Наши результаты показывают, что более теплое и быстрое производство может дать квашеную капусту с таким же микробным сообществом, что и квашеная капуста, полученная традиционными методами ферментации.Это может означать, что процесс быстрого брожения является жизнеспособным вариантом для промышленного производства квашеной капусты. Это может быть интересно для коммерческих производителей, поскольку это позволит им ускорить и расширить производство без ущерба для целостности сообщества ферментативных бактерий, что является центральным элементом предполагаемых пробиотических преимуществ квашеной капусты и других ферментированных продуктов.

Хотя проанализированные сообщества были примерно аналогичны ранее опубликованным данным по квашеной капусте, мы еще не можем утверждать, что продукты идентичны или что производственные процессы взаимозаменяемы.Есть несколько показателей — физические, сенсорные и питательные — которые не исследовались в рамках этого исследования и, возможно, могут варьироваться между двумя типами квашеной капусты. Мы предполагаем, что ухудшение внешнего вида, срока хранения, вкуса и питательной ценности более теплой квашеной квашеной капусты может отрицательно сказаться на ее коммерческой жизнеспособности. Следовательно, необходимы дополнительные исследования и измерения этих качеств до широкого коммерческого внедрения этого метода ферментации.

Благодарности

Исследовательская деятельность, связанная с этим исследованием, частично финансировалась Центром компьютерной биологии болезней человека COBRE (NIH P20 GM109035).Секвенирование проводилось в Центре геномики и секвенирования Род-Айленда, исследовательском центре NSF EPSCoR штата Род-Айленд, частично поддерживаемом Соглашением о сотрудничестве NSF ESPCoR № EPS-1004057. M.A.Z была поддержана стипендиатом Карен Т. Ромер по обучению и исследованиям, а также D.J.C. была поддержана стипендиями для аспирантов Национального научного фонда (грант № 1644760).

Вклад авторов

M. A.Z. и П. совместно разработали это исследование и собрали все образцы на производственном объекте.D.J.C, J.I.W. и M.A.Z. извлечена и подготовлена ​​ДНК для секвенирования. W.H.S. и D.J.C. выполнены все анализы. M.A.Z., W.H.S., D.J.C., J.I.W. и P.B. подготовил рукопись. Все авторы рассмотрели и одобрили его окончательную версию.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Ссылки

1. Trail A.C., Fleming H.P., Young C.T., McFeeters R.F. Химическая и сенсорная характеристика коммерческой квашеной капусты. J. Food Qual. 1996; 19: 15–30.DOI: 10.1111 / j.1745-4557.1996.tb00402.x. [CrossRef] [Google Scholar] 2. Варзакас Т., Закинтинос Г., Проэстос К., Радванска М. Ферментированные овощи. В: Йылдыз Ф., Вили Р.С., редакторы. Минимально обработанные охлажденные фрукты и овощи. Springer; Бостон, Массачусетс, США: 2017. С. 537–584. [Google Scholar] 3. Флеминг Х.П., Макфитерс Р.Ф., Даешель Р.Ф. Сборник методов микробиологического исследования пищевых продуктов. Американская ассоциация общественного здравоохранения; Вашингтон, округ Колумбия, США: 1992. Ферментированные и подкисленные овощи; стр.929–952. [Google Scholar] 4. Стамер Дж. Р., Стойла Б. О., Дункель Б. А. Скорость роста и закономерности ферментации молочнокислых бактерий, связанных с ферментацией квашеной капусты. J. Milk Food Technol. 1971; 34: 521–525. DOI: 10.4315 / 0022-2747-34.11.521. [CrossRef] [Google Scholar] 5. Cheigh H.S., Park K.Y. Биохимические, микробиологические и пищевые аспекты кимчи (корейские ферментированные овощные продукты) Crit. Rev. Food Sci. Nutr. 1994; 34: 175–203. DOI: 10.1080 / 10408399409527656. [PubMed] [CrossRef] [Google Scholar] 6.Сеттанни Л., Корсетти А. Применение бактериоцинов в биоконсервации растительных пищевых продуктов. Int. J. Food Microbiol. 2008. 121: 123–138. DOI: 10.1016 / j.ijfoodmicro.2007.09.001. [PubMed] [CrossRef] [Google Scholar] 7. Ли Х., Юн Х., Джи Й., Ким Х., Пак Х., Ли Дж., Шин Х., Хольцапфель В. Функциональные свойства штаммов Lactobacillus, выделенных из кимчи. Int. J. Food Microbiol. 2011; 145: 155–161. DOI: 10.1016 / j.ijfoodmicro.2010.12.003. [PubMed] [CrossRef] [Google Scholar] 8. Терпин В., Хамблот К., Гайот Дж.-П. Генетический скрининг функциональных свойств молочнокислых бактерий в суспензии ферментированного проса и в метагеноме ферментированных крахмалистых продуктов. Прил. Environ. Microbiol. 2011; 77: 8722–8734. DOI: 10.1128 / AEM.05988-11. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Юнг А., Вадстрём Т. Молочнокислые бактерии как пробиотики. Curr. Вопросы Intest. Microbiol. 2006; 7: 73–89. [PubMed] [Google Scholar] 10. Джи Ю., Ким Х., Пак Х., Ли Дж., Ли Х., Шин Х., Ким Б., Франц К.М.А.П., Хольцапфель В.H. Функциональность и безопасность штаммов молочнокислых бактерий из корейского кимчи. Пищевой контроль. 2013; 31: 467–473. DOI: 10.1016 / j.foodcont.2012.10.034. [CrossRef] [Google Scholar] 11. Кларк Т.К., Блэк Л.И., Стассман Б.Дж., Барнс П.М., Нахин Р.Л. Тенденции в использовании дополнительных подходов к охране здоровья взрослыми: США, 2002–2012 гг. Natl. Статистика здоровья. Отчет 2015; 79: 1–16. [Google Scholar] 12. Педерсон К.С., Олбери М.Н. Бюллетень: номер 824: Брожение квашеной капусты. Сельскохозяйственная опытная станция; Нью-Йорк, Нью-Йорк, США: 1969.[Google Scholar] 14. Пленгвидья В., Брейдт Ф., Лу З., Флеминг Х.П. ДНК-фингерпринт молочнокислых бактерий в ферментациях квашеной капусты. Прил. Environ. Microbiol. 2007. 73: 7697–7702. DOI: 10.1128 / AEM.01342-07. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Caporaso J.G., Kuczynski J., Stombaugh J., Bittinger K., Bushman F.D., Costello E.K., Fierer N., Peña A.G., Goodrich J.K., Gordon J., et al. QIIME позволяет анализировать данные секвенирования сообщества с высокой пропускной способностью. Nat. Методы. 2010. 7: 335–336.DOI: 10.1038 / nmeth.f.303. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16. Капорасо Дж. Г., Лаубер С. Л., Уолтерс В. А., Берг-Лайонс Д., Хантли Дж., Фирер Н., Оуэнс С. М., Бетли Дж. , Фрейзер Л., Бауэр М. и др. Сверхвысокопроизводительный анализ микробного сообщества на платформах Illumina HiSeq и MiSeq. ISME J. 2012; 6: 1621–1624. DOI: 10.1038 / ismej.2012.8. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 17. Уолтерс В., Хайд Э. Р., Берг-Лайонс Д., Акерманн Г., Хамфри Г., Парада А., Гилберт Дж.A., Jansson J.K., Caporaso J.G., Fuhrman J.A. и др. Усовершенствованный бактериальный ген 16S рРНК (V4 и V4-5) и праймеры для генов-маркеров внутреннего транскрибированного спейсера грибов для исследований микробного сообщества. mSystems. 2016; 1: e00009-15. DOI: 10.1128 / mSystems.00009-15. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Томпсон Л.Р., Сандерс Дж. Г., Макдональд Д., Амир А., Ладау Дж., Лосей К. Дж., Прилл Р. Дж., Трипати А., Гиббонс С. М., Акерманн Г. и др. Консорциум проекта «Микробиом Земли» Общий каталог раскрывает многомасштабное микробное разнообразие Земли.Природа. 2017; 104: 11436. DOI: 10,1038 / природа24621. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 19. Cabral D.J., Wurster J.I., Flokas M.E., Alevizakos M., Zabat M., Korry B.J., Rowan A.D., Sano W.H., Andreatos N., Ducharme R.B. и др. Микробиом слюны одинаков у разных субъектов и устойчив к воздействиям краткосрочной госпитализации. Sci. Отчет 2017; 7: 11040. DOI: 10.1038 / s41598-017-11427-2. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 20. Сюн Т., Гуань Ц., Сун С., Хао М., Се М. Динамические изменения флоры молочнокислых бактерий при брожении китайской квашеной капусты. Пищевой контроль. 2012; 26: 178–181. DOI: 10.1016 / j.foodcont.2012.01.027. [CrossRef] [Google Scholar] 21. Ли М., Сон Дж. Х., Юнг М. Ю., Ли С. Х., Чанг Дж. Ю. Масштабный целевой метагеномический анализ бактериальных экологических изменений в 88 образцах кимчи в процессе ферментации. Food Microbiol. 2017; 66: 173–183. DOI: 10.1016 / j.fm.2017.05.002. [PubMed] [CrossRef] [Google Scholar] 22. Ким М., Чун Дж. Структура бактериального сообщества в кимчи, корейской ферментированной овощной пище, по данным анализа гена 16S рРНК. Int. J. Food Microbiol. 2005. 103: 91–96. DOI: 10.1016 / j.ijfoodmicro.2004.11.030. [PubMed] [CrossRef] [Google Scholar] 23. Забат М.А., Сано В.Х., Кабрал Д.Дж., Вурстер Дж. И., Беленький П. Влияние веганского производства на микробиом кимчи. Food Microbiol. 2018; 74: 171–178. DOI: 10.1016 / j.fm.2018.04.001. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 24. Nguyen D.T.L., Van Hoorde K., Cnockaert M., De Brandt E., Aerts M., Binh Thanh L., Vandamme P. Описание микробиоты молочнокислых бактерий, связанной с производством традиционных ферментированных овощей во Вьетнаме.Int. J. Food Microbiol. 2013; 163: 19–27. DOI: 10.1016 / j.ijfoodmicro.2013.01.024. [PubMed] [CrossRef] [Google Scholar]

Как приготовить квашеную капусту

Домашняя квашеная капуста невероятно проста, и для приготовления этого вкусного пробиотического овощного фермента требуется всего несколько ингредиентов.

Ферментация — это древний метод консервирования продуктов, который возвращается, поскольку все больше людей осознают важность питательных пробиотических продуктов.

(Эта статья написана Мелиссой Кейзер, профессиональным организатором и поселенцем из штата Мэн.)

До охлаждения квашеная капуста была популярным способом сохранения большого количества свежих продуктов. Превращение капусты в капусту было способом гарантировать, что овощи будут есть в течение долгих зимних месяцев или голодных перерывов в вегетационный период.

С нашими современными продуктовыми магазинами, холодильниками и морозильниками и системой питания, обеспечивающей круглогодичный доступ к свежим продуктам, трудно представить себе, насколько важной была эта задача. Хотя мы больше не сталкиваемся с этой проблемой, ферментация — это ценный навык в любое время года.

Прежде чем приступить к приготовлению квашеной капусты, давайте поговорим о ферментации.

Как работает ферментация

Ферментация — это процесс превращения сырого овоща в другую форму, которая может храниться дольше, богата полезными пробиотическими бактериями и имеет другой вкус.

Овощи способны к брожению благодаря естественным микробам и сахару, содержащимся в овощах и на них. При правильных условиях эти пробиотические бактерии (также известные как молочнокислые бактерии) начинают есть сахар, содержащийся в овощах.

При этом образуется молочная кислота, которая затем превращает овощи в ферментированный рассол.

Говоря очень упрощенно, вы кладете овощ в банку и заливаете рассолом или его собственным соком. Затем вы используете какой-то вес, чтобы подтолкнуть овощи ниже уровня жидкости, создавая бескислородную область, в которой овощи могут трансформироваться.

Хранение овощей под жидкостью также защищает их от вредных бактерий, которые могут перемещаться в воздухе.

Со временем лакто-бактерии съедают сахар в овощах и превращают ваш простой овощ в богатый пробиотиками рассол или краут!

Что такое квашеная капуста?

Не вся квашеная капуста является пробиотиком, большая часть ее фактически консервирована и подвергнута термической обработке.То же самое и с солеными огурцами в наши дни, в то время как исторически «маринование» часто означало приготовление солений на основе лакто-брожения, в наши дни это чаще всего маринованные огурцы из укропа в домашних условиях или неизменно популярные соленья из хлеба с маслом.

Квашеная капуста — это капуста, прошедшая процесс лакто-ферментации. В результате вы получите квашеную капусту, богатую пробиотическими бактериями.

Консервированная квашеная капуста , однако, консервируется с использованием уксуса или тепла, или и того, и другого. Этот вид лечения убивает все присутствующие бактерии.Из них может получиться вкусный краут вместе со шпецле или сэндвичем с Рубеном, но в нем нет пробиотических свойств.

Есть много видов ферментированных овощей, а также способов их описания. Традиционно квашеную капусту готовят из капусты. В зависимости от рецепта вы можете добавить приправы или приготовить краут с другими овощами, такими как морковь или свекла.

Массаж домашней квашеной капусты вручную для приготовления рассола. Если приготовлено из свежей капусты, воду в закваску добавлять не нужно.Все, что вам нужно, это капуста и соль.

Состав квашеной капусты

Как правило, для приготовления квашеной капусты требуется несколько ингредиентов. Кочанная капуста и соль — это все, что необходимо, и даже соль необязательна в некоторых более сложных методах. Традиционные специи различаются в зависимости от региона, и их употреблять совершенно необязательно.

Капуста

Вы можете использовать красный или зеленый цвет, хотя зеленый более традиционный. Чем свежее капуста, тем лучше, поэтому, если у вас нет собственного огорода для сбора урожая, поищите кочаны на местной ферме, на фермерском рынке или в продуктовом магазине, где есть высокие обороты по продуктам.

Ищите те, которые кажутся плотными и тяжелыми, но некоторые пятна на внешних листьях в порядке, вы можете их очистить. Не кладите половину головы, о которой вы забыли, в заднюю часть холодильника, которая грустная, высохшая и гибкая.

Соль

Хотя можно приготовить квашеную капусту с низким содержанием соли или без нее, соль играет важную роль. Это помогает сохранить хрустящую корочку капусты, делая краут более приятным, но также помогает втягивать воду, которая действует как рассол.

Может показаться, что для одного рецепта нужно много соли, но помните, что вы не будете есть всю банку сразу, и это все равно, вероятно, будет меньше, чем в обычных коммерческих продуктах.

Соль также помогает сделать ферменты более безопасными для употребления в пищу, способствуя сохранению, она делает минералы более абсорбируемыми и улучшает вкус.

Можно использовать любую соль, если это чистая соль. Обычная йодированная соль содержит другие добавки и вещества, препятствующие слеживанию, иногда даже сахар для придания вкуса.Когда-нибудь посмотрите на этикетку с ингредиентами, и вы удивитесь, что скрывается в обычной 50-центовой банке с солью.

Я обычно использую кошерную или морскую соль, это просто соль без других добавок. Гималайская соль и консервированная соль также являются хорошими вариантами, поскольку они также не содержат несолевых добавок.

Дополнительные специи для квашеной капусты

Тмин и можжевельник — «классические» приправы для квашеной капусты. Это совершенно необязательно, и многие домашние рецепты квашеной капусты в наши дни просто придерживаются капусты и соли.

Добавление специй по вашему вкусу обычно не повлияет на фермент, и это действительно предел.

Оборудование для производства квашеной капусты

Помните, что ферментация — это древний способ консервирования продуктов, поэтому вы можете обойтись без всяких всяких всяких всяких всяких всяких изысков! Однако, помимо обычного кухонного оборудования, есть несколько вещей, которые облегчат процесс ферментации и помогут добиться большего успеха.

Емкость для брожения

Банки масона с широким горлом легко наполнить капустой, но я также использую обычный горлышко и плечи, чтобы овощи не попадали в рассол.Подойдет банка любого размера или бренда!

Требуется метод проб и ошибок, чтобы определить, какой размер банки вам нужен для того количества краута, которое вы готовите. Вы хотите, чтобы там было хотя бы несколько дюймов. Я обычно использую полтора фунта капусты и помещаю их в банку размером с кварту.

Хотя это и не обязательно, специализированный кувшин для брожения может стать отличным вложением, если вы ферментируете большие количества. Приготовление квашеной капусты в квашеной капусте — традиционный способ сбраживания квашеной капусты, и вы можете найти квашеную капусту с крышкой и водяным затвором или открытые кувшины.

Инструмент для измельчения квашеной капусты

Для того, чтобы приготовить квашеную капусту, вы должны вытащить жидкость из капусты, чтобы создать рассол. Для этого можно использовать руки, но если массировать капусту — не то, чем вы занимаетесь (или ваши руки устали), вы также можете ее растолочь.

Можно купить специальные удилища, но я использую конец своей французской скалки.

Использование французской скалки для приготовления квашеной капусты

Вес брожения

Вам понадобится что-нибудь, чтобы протолкнуть овощи в рассол.Есть много разных способов сделать это, многие из которых, вероятно, у вас уже есть дома.

Вот несколько идей:

  • Фляги меньшего размера ~ Вы можете использовать флягу меньшего размера, которая помещается в вашу основную флягу для брожения. Наполненный водой, он станет грузом поверх овощей.
  • Керамика Вес: Вы можете купить (или, если вы гончар, сделать свои собственные) керамические диски, которые поместятся внутри вашего сосуда.
  • Стеклянные гири ~ Подобно керамическим гирям, существует ряд компаний, производящих стеклянные гири для брожения, специально разработанные для использования в каменных сосудах.Их легко чистить, они доступны по цене и широко доступны.
  • Чистые камни ~ Найдите камень, который поместится в вашем сосуде, и прокипятите 20 минут, затем дайте остыть перед использованием в качестве груза. Если у вас большой сосуд, вы также можете использовать камень поверх тарелки, чтобы он действовал как более широкий груз.
  • Сумка с замком-молнией ~ При помещении в банку в незапечатанном виде поверх овощей, а затем наполнении водой, она действует как груз. Бонусные баллы, если вы используете рассол, в случае его утечки это не испортит вашу фермент.

Дополнительный воздушный шлюз для брожения

Вы можете безопасно и успешно ферментировать, оставив банку открытой на воздухе, просто накрыв ее тканью, чтобы внутрь не попадала пыль. Вот как делается квашеная капуста, когда вы используете открытую посуду.

Или вы можете использовать воздушный шлюз, который позволяет газам выходить, но не проникать внутрь.

Лично я предпочитаю использовать воздушный шлюз. Многие ферментирующие кувшины имеют встроенный воздушный шлюз, называемый гидрозатвором. У этого кувшина есть выступ, похожий на ров.Когда он заполнен, и крышка помещена в ров с водой, он действует как воздушный шлюз.

Вы также можете найти недорогие трехкомпонентные пластиковые шлюзовые системы того же типа, что и для домашнего вина. Затем эта универсальная система воздушного шлюза переходит в специальную крышку для ферментации, предназначенную для кувшина.

Существуют также силиконовые воздушные шлюзы, они долговечны и легко чистятся.

Как приготовить квашеную капусту

Приготовление квашеной капусты в домашних условиях начинается с ее приготовления.

Я использую полтора фунта капусты для этой партии, что составляет примерно половину кочана среднего и большого размера (обычно около 3 фунтов). Это примерно подходящее количество для банки размером с кварту.

Если вы один, чтобы мыть овощи, лучше просто прополоскать в холодной воде. Избегайте мытья рук с овощами, мылом или очень горячей водой. Удалите все поврежденные внешние листья капусты и вырежьте жесткую сердцевину.

Натереть капусту на терке или нарезать ломтиками.Я лично считаю, что на терке получается слишком мелкая капуста, поэтому используйте нож, чтобы нарезать капусту дольками, а затем тонкими ломтиками, но поэкспериментируйте с тем, что вам подходит.

После того, как капуста будет готова, всыпьте соль. Тщательные рецепты требуют, чтобы вы взвесили соль и добавили от 1,5 до 3% соли в зависимости от веса капусты. Это довольно широкий диапазон, и для 1 1/2 фунта капусты это где-то между 1/2 столовой ложкой и полной столовой ложкой.

Для литровой банки я бы посоветовал добавить одну столовую ложку соли, что требует осторожности и идеально подходит для начинающих ферментеров. Чем меньше соли, тем выше риск того, что бактерии порчи могут доминировать в контейнере до того, как соленолюбивые молочнокислые бактерии возьмут верх.

После того, как капуста и соль будут тщательно перемешаны, разотрите или помассируйте капусту, чтобы она высвободила сок. Этот сок будет рассолом для квашеной капусты, добавлять воду не нужно.

Продолжайте растирать или массировать капусту до тех пор, пока из нее не потечет значительное количество жидкости, что обеспечит погружение квашеной капусты в емкость для брожения.

Если вы хотите добавить специи, добавьте их сейчас. Я использую 1 столовую ложку семян тмина и 5 целых ягод можжевельника.

Квашеная капуста — это всего лишь несколько ингредиентов, и как только вы добавили соль и любые специи, пора переложить ее в емкость для брожения.

Добавьте капусту в емкость или банку и надавите руками, ложкой или молотком.Сверху должно быть не менее нескольких дюймов. Я использую литровую банку с широким горлышком, которая идеально подходит для половины кочана капусты (1 1/2 фунта), которую я использую.

Капуста имеет тенденцию к высыханию с возрастом, поэтому для квашеной капусты лучше всего использовать свежую капусту. Если ваша капуста просто не производит достаточного количества собственной жидкости, чтобы покрыть себя, отложите ее на несколько часов и посмотрите, выделяет ли она больше, если дать ей какое-то время.

Обычно капуста выделяет много жидкости, чтобы полностью погрузить квашеную капусту в течение 4-6 часов.В противном случае вам может потребоваться приготовить рассол, чтобы помочь. Смешайте 1 стакан воды с 1 чайной ложкой соли, затем вылейте ее в емкость, пока капуста не погрузится в воду.

Добавьте вес брожения на ваш выбор (описано выше). Это поможет протолкнуть капусту ниже рассола, который должен покрывать капусту как минимум на 1 дюйм жидкости.

Любой овощ над водой подвержен плесени, как если бы вы оставили этот овощ на прилавке, поэтому держите фермент в безопасности, полностью погружая его в воду.

Низкотехнологичный совет: Когда я использую квартовую банку с широким горлышком, как я делаю для этой партии, я предпочитаю сначала положить лист капусты, чтобы он служил «крышкой» для маленьких нарезанных кусочков моей квашеная капуста. Затем я использую банку с желе на 4 унции. Он находится чуть ниже края основной банки и вместе с более широким основанием капустного листа добавляет достаточно веса, чтобы капуста оставалась погруженной в воду. Я снимаю эту капустную «крышку», когда квашеная капуста перебродит, и выбрасываю ее.

Импровизированная гиря для брожения с использованием небольшой каменной кувшины.

Капуста и соль теперь находятся в банке и удерживаются ниже линии жидкости каким-то бродильным грузом. Воздушные шлюзы не являются обязательными, но если вы используете воздушные шлюзы, добавьте их сейчас.

В противном случае накройте открытый контейнер чистым кухонным полотенцем или марлей. Всегда рекомендуется ставить банку на полотенце или тарелку на случай, если рассол закипит.

А теперь самое сложное… терпение.

Рецепт ферментации квашеной капусты подскажет вам предполагаемое время, и это почти всегда окно.Идеальная температура для брожения — 64-75 градусов. В более теплых помещениях брожение будет происходить быстрее, в то время как брожение в более прохладных помещениях займет больше времени.

Я обычно жду от недели до 10 дней, а затем пробую пробу. На данный момент вкус будет довольно мягким, и многие люди предпочитают квашеную капусту примерно через 3 недели.

Вкус — это индивидуальное предпочтение, но ваш капуста должна быть немного кисловатой и маринованной. Если вы новичок в ферментированных продуктах, это может стать для вас новым вкусом.Хорошая закваска должна быть соленой, кислой и сложной.

Слегка неприятный запах (подумайте, хороший, пахнущий сыр) не означает, что он плохой, но они не должны иметь вкуса или запаха плесенью или плесенью.

Хранение квашеной капусты

После того, как он ферментирован до желаемой степени готовности, снимите воздушный затвор или ткань, закрутите крышку и храните в холодильнике.

Холод помогает замедлить процесс, но не останавливает его полностью. Пробиотические молочнокислые бактерии все еще работают даже в холодильнике, а квашеная капуста будет продолжать ферментировать и медленно меняться с течением времени.

Если у вас есть холодный подвал, вы также можете держать краут под воздушным шлюзом и использовать по мере необходимости. Обязательно вдавите краут под рассол.

Нормальные части брожения квашеной капусты

Если вы новичок в ферментации, полезно знать, что нормально во время любого брожения. (Как и то, что нет…)

Пузыри

По мере того, как происходит магия брожения, выделяются газы, в основном двуокись углерода.Вы увидите, как в банке образуются пузырьки, похожие на пузырьки шампанского, или пена на поверхности рассола.

Если вы используете воздушный шлюз, вы можете увидеть, как пузырьки газа проходят сквозь него, или иногда появляются бугорки, когда они проходят через гидрозатвор.

Замена рассола

Скорее всего, рассол станет мутным, и на дне сосуда может образоваться осадок. Некоторые овощи, такие как редис или краснокочанная капуста, также меняют цвет рассола.

Запах

Ваши ферменты — это волшебный сосуд, в котором бактерии едят и пугают.Когда капуста трансформируется, она может пахнуть. Подумайте о грязных носках или вонючем сыре. Если вы чувствительны к запаху, попробуйте использовать воздушный шлюз.

Форма

Если вы видите плесень сверху, это означает, что над рассолом находятся овощи, которые подвергаются воздействию воздуха, в результате чего они покрываются плесенью. Это не обязательно означает, что фермент испортился.

Вы можете соскрести эту плесень и верхний слой капусты, добавить еще рассола и дать продолжить брожение или переместить в холодильник, если они готовы.

Если плесень распространяется на овощную массу или много темной плесени, ее следует выбросить.

Варианты квашеной капусты

После того, как вы приготовили несколько успешных партий квашеной капусты, не стесняйтесь экспериментировать с вариациями. Вы сами делаете закваску, а это значит, что вы можете настроить вкус, цвет и текстуру в соответствии со вкусами вашей семьи.

Рассмотрите возможность добавления любого из следующего:

  • Специи ~ Можжевельник и тмин являются традиционными, но черный перец может добавить приятное легкое тепло.Если вы любите готовить квашеную капусту с яблоками и сосисками, то к блюду также можно добавить теплые специи, такие как корица и душистый перец.
  • Овощи ~ Другие листовые овощи прекрасно сочетаются с квашеной капустой, и они могут добавить цвет и аромат готовой капусте. Также часто добавляются мелко нарезанные кубиками корнеплоды, такие как морковь, свекла и редис.
  • Фрукты ~ Хотя мягкие фрукты не так уж распространены, нарезанные кубиками яблоки и груши придают квашеной капусте невероятный аромат.Добавляйте их в умеренных количествах, так как слишком много фруктов приведет к небольшому алкогольному брожению из-за добавленных сахаров (в отличие от желаемой молочнокислой бактериальной ферментации).

Другие простые домашние продукты с пробиотиками

Заинтересованы в брожении? Попробуйте любой из этих простых рецептов ферментации:

Связанные

Лабораторные упражнения по ферментации квашеной капусты

Переливание квашеной капусты в консервный цех старого завода Frank Pure Food Co.во Франксвилле, штат Висконсин — октябрь 1926 г.

Квашеная капуста по определению является «кислой капустой». Это результат естественного брожения бактериями, присущими капусте, в присутствии 2-3% соли. В результате ферментации основным продуктом является молочная кислота. Эта молочная кислота вместе с другими второстепенными продуктами брожения придает квашеной капусте характерный вкус и текстуру.

При производстве квашеной капусты зрелые кочаны моют и измельчают.Соль смешивают с нашинкованной капустой до конечной концентрации около 2,5%. Затем соленую капусту плотно укладывают в ярус или кувшин. Капуста защищена от воздуха (кислорода) таким образом, чтобы газы, образующиеся во время ферментации, могли улетучиваться. Для ферментации предпочтительна температура около 70 ° F. Для полного брожения требуется около пяти недель.

Соление капусты служит двум основным целям. Во-первых, это вызывает осмотический дисбаланс, который приводит к высвобождению воды и питательных веществ из листьев капусты.Выбрасываемая жидкость является отличной средой для роста микроорганизмов, участвующих в ферментации. Он богат сахаром и факторами роста. Во-вторых, используемая концентрация соли подавляет рост многих вызывающих порчу организмов и патогенов. Очевидно, это не препятствует желаемой цветочной последовательности. Поскольку капуста примерно на 90% состоит из воды, а соль полностью растворена в воде, фактическая концентрация соли (сила рассола), испытываемая микроорганизмами в их водной среде, составляет около 2.8%. Тщательное и равномерное распределение соли имеет решающее значение. Места с низкой или высокой концентрацией соли могут привести к порче и / или отсутствию желаемой ферментации.

Какой-то «капустный стаканчик», сделанный из измельченной красной капусты и утяжеляемый меньшим стаканом, наполненным водой. Слой минерального масла, плавающий на отжатом соке, предотвращает проникновение кислорода; Кислород, который был в соке и листьях капусты первоначально, был выдохнут в результате метаболизма бактерий и растений.Нажмите на изображение для увеличения.

Во время ферментации очень важно исключить кислород . Присутствие кислорода может способствовать росту некоторых организмов, вызывающих порчу, в частности, кислолюбивых плесени и дрожжей.

Поскольку в систему не добавляются заквасочные культуры , это называется дикой ферментацией . Считается, что нормальная флора капустных листьев включает в себя организмы, ответственные за желаемую ферментацию, которая улучшит сохранность и органолептическую приемлемость.Последовательность цветков в основном регулируется pH среды для выращивания.

Первоначально ферментация начинается с кишечной палочки . Колиформные бактерии, которые в последние годы способствовали получению квашеной капусты в лаборатории, были идентифицированы как Klebsiella pneumoniae , K. oxytoca и Enterobacter cloacae . По мере производства кислоты быстро образуется среда, более благоприятная для Leuconostoc . Популяция кишечной палочки уменьшается по мере роста популяции штамма Leuconostoc .Поскольку Leuconostoc является гетероферментативной молочнокислой бактерией, на этой стадии образование кислоты сопровождается большим количеством газа (диоксида углерода). Уровень pH продолжает падать, и штамм Lactobacillus сменил штамм Leuconostoc . (Иногда вместо Lactobacillus возникает штамм Pediococcus ). Таким образом, полная ферментация включает в себя последовательность трех основных групп или родов бактерий, последовательность которой определяется снижением pH.Иногда было обнаружено, что накопленная кислота убивает организмы, участвующие в ферментации.

Интересные организмы были выделены в ходе нашего лабораторного курса пищевой микробиологии, в том числе предположительно колиформный, ферментирующий лактозу организм из раннего образца, который образовывал странно выглядящие колонии на агаре МакКонки. Этот организм был идентифицирован системой API-20E как Enterobacter agglomerans , «вид», который был удобной свалкой для организмов, которые лучше идентифицировать как Pantoea ; безусловно, этот конкретный штамм нельзя рассматривать как типичный ни для одного из таксонов.

В этом упражнении капуста будет очищена, нашинкована и солена. Соленая капуста будет упакована в горшок, который затем запечатан, чтобы исключить доступ кислорода. По мере отжима сока на него наносят покрытие, чтобы контролировать последовательность цветков. Сок также будет титроваться для определения общей кислотности и отслеживания снижения pH. Когда ферментация завершится примерно через пять недель, органолептическая приемлемость продукта будет определена в Ежегодном отделении бактериологии Kraut-Fest.


«СРОК ИЗГОТОВЛЕНИЯ» (t = 0 дней)

Материалы
  • Свежие кочаны
  • Большие ножи
  • Измельчители капусты
  • Контейнеры для нашинкованной капусты
  • Весы и бумага для взвешивания
    (коммерческий класс)
  • Большие глиняные или вощеные глиняные кувшины с вощеными крышками и грузиками
  • Марля
Процедура (выполняется определенными группами студентов и командой добровольцев по уборке)

1.Обрежьте кочаны, удалив внешние листья и все ушибленные или загрязненные ткани.

2. Тщательно промойте обрезанные головки водопроводной водой.

3. Разрежьте головки пополам, удалив твердую центральную сердцевину.

4. Измельчите капусту измельчителем. Будьте осторожны, чтобы не порезать пальцы !!

5. Взвесьте нашинкованную капусту. Добавьте соль так, чтобы конечная концентрация составляла 2,5%. Полное и равномерное перемешивание соли очень важно!

6.Поместите нашинкованную капусту в кувшины так, чтобы они заполняли примерно 75-80% от общего объема. Умеренно сожмите смесь, избегая при этом раздавливания или повреждения ткани капусты.

7. Добавьте крышку и грузы и накройте марлей.

8. Инкубируйте черепки при температуре от 21 до 24 ° C в течение 5-6 недель.


ПЕРИОДИЧЕСКИЕ ПЕРИОДЫ ПОСАДКИ

(для образцов сока квашеной капусты, взятых на 0, 1, 2 (или 3),
4 (или 5), 14 и 35 дней инкубации)

Материалы для подсчета жизнеспособности и прямого микроскопические наблюдения
  • 1 образец сока объемом 3 мл для покрытия и микроскопии

    Примечание. Образцы 0 и 1 дня будут предоставлены неразбавленными.Образцы на срок от 2 до 35 дней будут предоставлены в разведении 1/10, которое необходимо учитывать при процедуре разбавления / посева.
  • 5 или 6 девяти мл контрольных растворов (физиологический раствор или 0,1% пептон)
  • 4 чашки PCA (агар для подсчета на чашках)
  • 4 чашки MAC (агар МакКонки)
  • 4 чашки HIAS ( Сердечный инфузионный агар + 5% сахарозы, 0,5% глюкозы и 0,02% азида натрия)
  • Пипетки и стерильные наконечники
Материалы для определения pH и кислотности
  • 1 образец сока квашеной капусты (неразбавленный) объемом десять мл для титрования
  • Колба Эрленмейера
  • Аппарат для титрования с 0.1 M NaOH и 1,0% фенолфталеин
  • pH-бумага
Процедура

1. Подсчет жизнеспособности и прямые микроскопические наблюдения (выполняется всеми людьми):

  • Предлагаемые разведения в чашках для различного времени отбора проб следующие:
    день выборки PCA MAC HIAS
    0 или 1 10 –1 , 10 –2 , 10 –3 , 10 10 –2 , 10 –3 , 10 –4 , 10 –5 10 –1 , 10 –2 , 10 –3 , 10 –4
    2 или 3 10 –4 , 10 –5 , 10 –6 , 10 –7 10 –4 , 10 –5 , 10 — 6 , 10 –7 10 –2 , 10 –3 , 10 –4 , 10 –5
    4 или 5 10 –4 , 10 –5 , 10 –6 , 10 –7 10 –3 , 10 –4 , 10 –5 , 10 –6 10 –4 , 10 –5 , 10 –6 , 10 –7
    14 или 35 10 –4 , 10 –5 , 10 –6 , 10 –7 10 –2 , 10 –3 , 10 –4 , 10 –5 10 –2 , 10 –3 , 10 –4 , 10 –5
  • Приготовьте десятичные разведения сока (которые могут быть или не могут быть уже разведены до 10 –1 ; см. раздел Материалы) и табличку 0.По 1 мл на каждую чашку, чтобы достичь указанных выше разведений.
  • Инкубируйте все чашки при 30 ° C в течение 2-3 дней.
  • Приготовьте пятно массой грамм образца сока. Наблюдайте и записывайте грамм-реакции и морфологию преобладающей флоры.

2. Определение кислотности и pH (выполняется выбранными лицами поочередно):

  • Используя pH-бумагу, определите pH пробы неразбавленного сока.
  • Добавьте 10 мл неразбавленного сока в колбу Эрленмейера. Добавьте 10 мл дистиллированной воды. (Почему количество воды не критично для расчетов?) Прокипятите колбу в течение 1 минуты, чтобы удалить растворенный углекислый газ. Остудить и добавить 5 капель фенолфталеина. Титровать 0,1 М NaOH до сохранения светло-розового цвета. Используя следующую формулу, рассчитайте процентное содержание молочной кислоты (преобладающая нелетучая кислота, ожидаемая при брожении квашеной капусты):% молочной кислоты = [(мл 0.1 M NaOH) X (0,9)] / [объем образца]

ПЕРИОДЫ ПОДСЧЕТА КОЛОНИЙ И НАБЛЮДЕНИЙ

(выполняется через 2-3 дня после соответствующего периода покрытия, указанного выше)

Материалы
  • 1 флакон-капельница 3% перекиси водорода
Процедура

1. Убедитесь, что вы правильно промаркировали каждую чашку с указанием правильного разведения на чашке.

2. Определите КОЕ / мл для каждого из следующих значений:

  • Общее количество аэробных бактерий на чашке на основе результатов PCA.Обязательно подсчитайте все колонии, большие и маленькие. (Желтые колонии, появляющиеся на ранней стадии ферментации, скорее всего, являются кишечными бактериями, связанными с растениями, принадлежащими к так называемой группе « Erwinia herbicola-Enterobacter agglomerans ». Эти организмы в настоящее время обычно классифицируются как род Pantoea .)
  • Общее количество грамотрицательных клеток на основе результатов MAC. Количество колиформных бактерий можно оценить путем подсчета красных и розовых колоний.
  • Общее количество слизеобразующих колоний на основе подсчета слизистых колоний с помощью HIAS. Подсчитывайте только относительно большие, почти молочные или водянистые колонии. Это количество соответствует уровню Leuconostoc в квашеной капусте.
  • Подсчет молочнокислых бактерий может быть определен путем подсчета всех колоний на HIAS. Альтернативно, H 2 O 2 может быть нанесен на пластину PCA, подсчитанную выше; доля каталазонегативных колоний представляет собой уровень молочнокислых бактерий в квашеной капусте.

3. Предоставьте результаты, используя предоставленную форму. Данные среднего класса будут доступны для каждого периода отбора проб. Потребуется график, показывающий общее количество и количество трех бактериальных групп (все основано на усредненных данных по классам), поскольку они «растут и падают» с течением времени. Убедитесь, что на своем графике вы используете правильную шкалу времени; не устанавливайте разные времена выборки через равные интервалы!


1998 РЕЗУЛЬТАТЫ КЛАССА

Обратите внимание, что в некоторых случаях общее количество меньше одной из отдельных составляющих культур.Тем не менее, он все еще находится в стадии разработки и, вероятно, был бы более реалистичным с лучшими методами гальванизации и подсчета и большим количеством отдельных образцов.

Определение количества Lactobacillus теоретически равно общему количеству молочнокислых бактерий за вычетом количества Leuconostoc . При построении графика результатов интересно увидеть, как любое количество Lactobacillus будет затмеваться счетчиком Leuconostoc для обеих партий через 5 дней.Можно задаться вопросом, не обнаруживаем ли мы «разные молочные продукты» (не обязательно только Lactobacillus ) в образцах 0–2 дня.

Партия A
день общее количество аэробных бактерий / мл общее количество грамотрицательных бактерий / мл общее количество молочнокислых бактерий / мл Leuconostoc количество / мл %

  • молочная кислота
  • 0 2,6 X 10 7 7,0 X 10 6 1.4 X 10 3 2,4 X 10 2 0,081
    1 4,5 X 10 6 1,0 X 10 6 8,4 X 10 8 5 9,1 10 5 0,086
    2 3,7 X 10 7 2,3 X 10 4 1,7 X 10 6 4,8 X 10 5 36

  • 5 1.8 X 10 7 слишком мало
    для подсчета
    3,2 X 10 7 3,2 X 10 7 0,42
    14 2,1 X 10 904 слишком мало
    для подсчета
    2,2 X 10 7 слишком мало
    для подсчета
    1,4
    35 1,9 X 10 5
    для подсчета 1.3 X 10 5
    слишком мало
    для подсчета
    1,6
    Партия B

    91 количество кислых бактерий / мл

    день общее количество аэробных пластинок / мл общее количество грамм-отрицательных количеств / мл 106 всего Leuconostoc количество / мл % молочная кислота
    0 1,2 X 10 7 1,3 X 10 6 4,3 X 10 8 3 .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    2021© ООО "ИФК Аптеки"
    Все права защищены.
    Использование материалов с сайта без согласования с администрацией сайта запрещено.