Сколько времени квасится капуста в тепле: «Сколько нужно квасить капусту в тепле?» – Яндекс.Кью

Содержание

Квасить надо правильно

У многих приморских дачников кочаны, предназначенные для квашения, сегодня еще красуются в огороде. И вот почему. — Квасится капуста за счет образования в ней молочной кислоты, а чтобы она появилась, капуста должна набрать наибольшее количество природных сахаров, — объясняет владивостокский агроном Валентина Безкоровайная. — Растению удается это сделать лишь поздней осенью.

У многих приморских дачников кочаны, предназначенные для квашения, сегодня еще красуются в огороде.
И вот почему. — Квасится капуста за счет образования в ней молочной кислоты, а чтобы она появилась, капуста должна набрать наибольшее количество природных сахаров, — объясняет владивостокский агроном Валентина Безкоровайная. — Растению удается это сделать лишь поздней осенью.

Заморозки и даже такая погода, какая была в прошлую пятницу, кочанам на грядках не страшны. Примерно через неделю капусту сорта Слава 1305 и других поздних сортов можно будет убирать с грядки.

Подходит пора квасить. Правила тут простые.

Кочаны для этого дела надо брать плотные, неподгнившие и желательно белые. Сперва нужно их зачистить. Снимите с них зеленые листья, хорошо промойте и разложите на полотенце, чтобы обсохли. Эти листья потом положите на дно емкости, в которой будете квасить капусту.

Разрежьте кочаны пополам, вырежьте кочерыжку и нашинкуйте капусту соломкой. Переложите ее в подготовленную посуду, пересыпая солью и очень плотно утрамбовывая. Ведь витамин С, который легко разрушается на воздухе, лучше сохраняется в плотно утрамбованной капусте.

Можно добавить натертую крупно морковь, бруснику, нарезанные полосками стручки болгарского перца. Утрамбованную вместе с этими добавками капусту закройте оставшимися зелеными листьями и положите сверху гнет, вес которого должен быть не менее 10 процентов от веса капусты.

На два-три дня оставьте ее в кухне для брожения. Много сока будет через сутки, затем образуется серовато-бурая пена, которую надо удалять. Если пену не удается снять с листьев, то промойте их и снова положите на капусту. Чистой заостренной палочкой время от времени делайте в ней проколы. Через трое суток емкость нужно будет перенести в более холодное место. А окончательно квашение завершится через 10-15 дней. Рассол к этому времени станет прозрачным, без горечи.

А вот самый распространенный рецепт: на 10 кг капусты — 250 г соли. Добавки по выбору: 250 г моркови, 500 г яблок, 250 г сладкого перца, 250 г брусники, пять граммов пряностей — анис, мята, тмин.

Быстро — не значит плохо

Чтобы заквасить капусту, требуется много времени. Но у некоторых хозяек есть проверенные способы заквасить в предельно короткие сроки. Причем быстро не будет значить плохо — капуста получается сочная и ароматная. Именно такими рецептами на днях поделились с корреспондентами «В» дачницы из садоводческого общества «Учитель», что неподалеку от станции Спутник.

С хлебом. Возьмите полтора килограмма капусты побелее, нашинкуйте, добавьте морковь, присыпьте половиной столовой ложки соли и слегка примните рукой.

На дно кастрюли положите четверть горбушки ржаного хлеба, накройте его капустным листом, выложите подготовленные овощи и сверху — листья.

Накройте кастрюлю салфеткой и на четыре дня поставьте в теплое место. Не забывайте, что капусту надо обязательно протыкать до дна деревянной палочкой или черенком длинной деревянной ложки. Готовую капусту уберите на холод.

С хлебом и свеклой. Зачистите кочан, разрежьте его на четыре части и залейте горячим (80-85 градусов) рассолом, который должен полностью покрыть капусту.

Когда рассол остынет, между частями кочана положите корочки черного хлеба. Захотите — можете добавить натертую крупно сырую свеклу. Оставьте капусту при комнатной температуре. Она будет готова через трое суток.

На килограмм капусты идет литр воды, 30 граммов соли, пять граммов черного хлеба, пять граммов семян укропа или тмина.

С перцем. «Готовлю в пятилитровой банке, — говорит Нина Попова. — На этот объем требуется четыре небольших кочанчика капусты, разрезанных на четыре части, четыре моркови (режу вдоль), три свеклы (режу поперек), 15 зубков чеснока и стручок жгучего перца.

На дно банки кладу половинку перца, а на него послойно морковь, свеклу, чеснок, капусту. Сверху кладу оставшуюся половинку перца и горсть соли. Заливаю банку холодной кипяченой водой. Держу капусту в тепле три-четыре дня, а потом на холоде столько же. Ну а потом уже можно ее поедать. Кстати, долго хранить такую капусту нельзя».

Четвертинка с начинкой

Фирменное блюдо Елизаветы Васильковой из садоводческого общества «Железнодорожник» — фаршированная капуста. Приготовить ее несложно.

— Небольшие рыхлые кочанчики разрежьте на четыре части, — советует Елизавета Петровна, — обдайте кипятком и остудите. Между листьями положите ломтики яблок, моркови, корня петрушки. Сюда же можно добавить — но это на любителя — ломтики «зимней» груши. Впрочем, чередование продуктов, которые я закладываю между листьями, может быть произвольным.

Нафаршированные четвертинки капусты уложите в кастрюлю и залейте раствором: на литр воды 50 граммов соли, столовая ложка свекольного сока.

Все это надо закрыть тканью и положить под легкий груз. Кастрюлю оставить на неделю при комнатной температуре, а после этого капусту можно подавать на стол.

Хороша закуска!

В садоводческом обществе «Букет» у многих есть свои рецепты приготовления отличной квашеной капусты. Однако как о лучшей закуске обычно отзываются об острой капусте Ольги Мануйловой. А она охотно раскрывает свои «секреты».

— Надо порезать на крупные, по 200-300 граммов, куски белокочанную капусту, добавить по 25 граммов мелко нарезанного чеснока и петрушки, натертого хрена, стручок горького перца и свеклу, порезанную на крупные кубики, — говорит Ольга Ивановна.

— Подготовленную капусту со всем набором приправ нужно залить теплым рассолом: на литр воды по 50 граммов соли и сахара. После этого сверху надо положить гнет и оставить капусту на сутки в теплом месте. Затем перенести на холод. А через пять дней можно есть.

Два дня — и готово

Вот-вот произойдет какое-то семейное событие, придут гости.

Хочется подать к званому ужину вкусную капусту.

— Если вам необходимо порадовать гостей буквально через пару дней, воспользуйтесь моим рецептом, — делится собственной технологией Галина Бадерина из дачного общества «Нива». — В большую кастрюлю уложите нарезанную пластинами по полсантиметра свеклу. Возьмите маленькие кочаны капусты. Их нужно нарезать на восемь кусков, перерезая кочерыжку. Крупно нарезать чеснок, сельдерей. Затем опять свеклу, капусту, чеснок, сельдерей и так далее. А потом залить капусту с этими приправами горячим рассолом: на литр воды — столовая ложка соли. Вот увидите, ваша семья и гости будут в восторге!

В полнолуние — нельзя

Как-то довелось журналистам «В» побывать в Полтавке. В этом селе живет немало умелых огородников, и все они заготавливают на зиму дивную хрустящую квашеную капусту. Чтобы она получалась такой, нужны и навык, и фантазия. Одна из местных мастериц, Наталья Губкина, подсказала нам некоторые тонкости.

— На 10 килограммов капусты беру 700-800 граммов моркови и 200-250 граммов соли, — уточнила Наталья Николаевна. — Добавляю и сахар, но не более 50 граммов. Традиционно капусту квасят с морковью. А можно ведь приготовить и с лавровым листом, и с тмином. Если добавить корень и листья хрена, то капуста будет отлично хрустеть.

Можно приготовить ее и с болгарским перцем, со свеклой. А можно и так поступить. В кадушку с шинкованной капустой добавить несколько небольших вилков краснокочанной капусты, сдобрить анисом, семенами горчицы. Капуста получится розовой и очень аппетитной.

И последний совет. Не квасьте капусту в полнолуние!

С чесночком и лучком

— Мою квашеную капусту все знакомые считают оригинальной, — рассказывает Валерий Васин из дачного общества «Медик». — Вот как нужно делать, чтобы получилось особенно аппетитно. Кочан капусты порежьте на кубики. Варите три свеклы и пять морковок десять минут, остынут — также порежьте на кубики. Очистите две головки чеснока, обдайте кипятком и крупно порежьте. Разделите на четыре части пять средних головок репчатого лука. Все овощи перемешайте и выложите в кастрюлю.

Залейте холодным рассолом: на литр воды — столовая ложка соли с горкой. Сверху положите гнет и оставьте в тепле на три дня. Затем уберите в холодильник.

Автор: Светлана ЖУКОВА, Василий ФЕДОРЧЕНКО (фото), «Владивосток»

Сколько квасится капуста в тепле. Как квасить капусту на зиму в дубовой кадке — видео рецепт

Я квашу капусту в домашних условиях постоянно, практически круглый год.

Использую 3-х литровую стеклянную банку. Технология отработана почти до совершенства (на дно банки — корку черного хлеба, плотно утрамбовать капусту, смешанную с морковью и солью, протыкать дважды в сутки, сок доливать обратно в банку). И всегда моя капуста готова на третьи сутки после приготовления.

Чтобы узнать, готова ли капуста, просто попробуйте на вкус — должно быть достаточно кислоты.

Спустя трое суток после приготовления, я убираю банку с капустой в холодильник, где она благополучно хранится (но недолго — всё съедается в течение следующих 4-5 дней).

★★★★★★★★★★

Комментарии

Все правильно. Только хотелось бы без черного хлеба.

Чем Вам не нравится черный хлеб? Вы теоретик или практик? Корка черного хлеба ускоряет процесс брожения, необходимый для закваски. К тому же, вопрос задавали не Вы)) (это по поводу «Хотелось бы без…..») В авторском вопросе вообще нет ничего о черном хлебе, а только про сроки квашения. Про мой личный опыт — прошу в «личку».

А вообще, можете делать так, как хотите (и без черного хлеба). Ваше право)) После напишите, пожалуйста, как получится Ваша квашенная капуста, и как Вы её делали. Благодарю за ответ))

Капуста квасится дней 5.

Ее шинкуют, солят и давят руками так, чтобы начал выделятся сок. Еще в капусту добавляют морковь и свеклу.
Порциями капусту загружают в большую емкость (бачок или кадушку).
Когда емкость заполнена, на нее кладут сверху кружок и задавливают грузом.
Емкость оставляют в доме на несколько дней. В это время она должна закиснуть и перебродить.
Каждый день капусту следует протыкать деревянным колом, для того, чтобы выпустить газ.
Пока капуста будет квасится,будет исходить кислый запах.
Вот как этот запах прекратится, тогда капуста и считается заквашеной.

После этого капусту перекладывают в банки и спускают в подвал на хранение.
Окончательно капуста становится пригодной к пище через месяц.

Сейчас, когда работает отопление, капуста закисает быстрее.

За 2-3 дня можно получить отличный продукт.

Шинкуете, солите, перемешиваете вместе с морковкой или без неё — на вкус она особо не влияет. (Считается, что немного добавляет сласти, и с ней капуста становится как-то красивее и «веселее».) Мнёте руками активно, до появления сока и убираете под гнёт. Чтобы верхний слой не заветрил и не потемнел на воздухе, на верх кладётся большой лист или чистая тряпочка. На неё — «кружок», большую тарелку или крышку с грузом. Через 2 дня, если заквашивается капуста в отапливаемом помещении, просто пробуете. Если совпадает с вашими представлениями о кислой капусте — убираете груз и протыкаете несколько дырочек в капусте до самого дна, «чтобы вышла горечь».

Ещё через день можно фасовать и убирать в холодильник.

Капуста перекисшая, а тем более, забродившая, поверьте, хуже, чем недокисшая — она «дойдёт» в таре, обязательно возьмёт своё. А, вот перекисшая сгодится только на щи и на солянку.

Пахнуть она должна не кислятиной и не спиртом (тем более, не тухлятиной!), а источать особый дух, возбуждающий аппетит. И на зубах должна хрустеть.

Выходит много сока, особенно, когда мнёте капусту. Он пойдёт в работу. Когда капуста будет стоять под гнётом, ёмкость с ней ставится в другую ёмкость, куда будет собираться сок.

Немного сока можно подлить в расфасованную капусту, если она кажется сухой. Оставшийся не выливайте! Это — отличный витаминный бальзам, помогающий, к тому же, от целого ряда недомоганий. Храните его в баночке в холодильнике.

Так что в тёплом помещении все циклы укорачиваются. Имейте это в виду.

★★★★★★★★★★

Раньше, когда мы солили капусту, она была готова уже на третий день. Но в последние два года на засолку уходит больше времени, хотя температура в квартире не изменилась.

Думаю, все же играет роль сорт капусты. До этого в засолку шла капуста со своего участка — Подарок, Слава и Грибовская поздняя. Сейчас участка нет, приходится покупать. Но каких она сортов мы не знаем.

Капусту солим как обычно: шинкуем мелко, добавляем тертую морковь, солим только крупной (каменной) солью. Если есть семена укропа добавляем и его, а также лавровый лист. Каждый ряд уминаем плотно. После чего, покрываем салфеткой и кладем гнет.

Когда капуста начинает хорошо пузыриться, протыкаем раза два, чтобы вышли газы. Если она стала мягче, значит готова. Перекладываем в пакеты и в морозилку или же на балкон, если температура минусовая.

Приветствую Вас, уважаемые читатели!

Сегодня расскажу Вам о том, как правильно квасить капусту , опираясь на свой многолетний опыт в этом тонком деле.

Для квашения лучше брать сорта капусты позднего и среднего сроков созревания, например, можно использовать сорта «Мидор F1», «Юбилейный F1», «Подарок», «Менза F1», «Тюркиз», «Судья 146», «Краснодарская1».

В моем арсенале много рецептов квашения капусты, каждый из которых отличается своим оригинальным вкусовым оттенком.

Сначала нужно удалить зеленые и поврежденные листья, потом вырезать кочерыгу и нашинковать. Можно конечно шинковать капусту с помощью специальных средств современной бытовой техники, но я всегда соблюдаю дедовские традиции и делаю это вручную с помощью обычной тяпки и деревянного корытца.

Очень важно при квашении капусты правильно соблюдать пропорции:

Рецепт 1: «С морковкой»

На 10 килограмм шинкованной капусты я добавляю 350 грамм измельченной моркови и 180 – 200 грамм крупной поваренной соли. Никогда не используйте для любых заготовок мелкую йодированную соль.

Рецепт 2: «С яблочками»

На 10 килограмм шинкованной капусты добавляю 1 килограмм яблок, нарезанных половинками, сердцевины с семечками предварительно удаляю, и 180 – 200 грамм соли.

Рецепт 3: «Северный»

На 10 килограмм нашинкованной капусты беру 350 грамм клюквы и 180 – 200 грамм соли.

Рецепт 4: «Оригинальный вкус»

На 9 килограмм шинкованной капусты беру 500 грамм яблок, нарезанных половинками и с удаленной сердцевиной, 1 килограмм измельченной моркови, 10 грамм тмина и 160 – 180 грамм соли крупного помола.

Рецепт 5: «Ароматный»

К 10 килограммам шинкованной капусты нужно добавить 350 грамм моркови, 180 – 200 грамм поваренной соли и 5 грамм лаврового листа.

Чтобы правильно квасить капусту , необходимо защитить ее от соприкосновения с воздухом, так как при поступлении воздуха происходит уменьшение количества аскорбиновой кислоты при квашении. А наличие аскорбиновой кислоты – важнейший момент для получения качественной и вкусной квашеной капусты.

Посмотрите видео о том. как квасить капусту в дубовой бочке (Сайт distilliruem.ru)

Капусту с рассмотренными выше добавками нужно перемешать и уложить в кадки, бочки, кастрюли, ведра. После этого надо закрыть ее сверху целыми промытыми капустными листьями, потом накрыть все это белой прокипяченной тканью, а потом подгнётным (лучше деревянным) кругом. Сверху надо положить гнёт (груз), составляющий по весу примерно 10 – 15 % веса от заложенной в емкость, капусты. В качестве гнета можно использовать любой груз (камень, ведро или кастрюлю с водой). Затем все это нужно накрыть полиэтиленовой пленкой.

В помещении, где квасится капуста, первые 4 – 6 дней, нужно поддерживать температуру 17 – 20 градусов. Тогда капуста получится высокого качества, будет содержать больше сахара и малое количество летучих кислот, в ней лучше сохранится витамин С.

Когда закончится период активного брожения, лучше поместить капусту в холод — 0 – (-2) градуса. При этой температуре задерживается развитие плесени, которая образуется только при доступе кислорода. Плесень разлагает молочную кислоту и как следствие, происходит ухудшение качества нашей квашеной капусты.

Квасить капусту можно и в мешках из полиэтилена, которые укладываются в кастрюли и бочки. При таком методе можно использовать только мешки из пищевой пленки.

Вот, наконец, Вы научились правильно квасить капусту и изготовили первый «квашеный» бочонок, но у Вас нет возможности создать условия для длительного хранения. В этом случае поможет метод консервирования:

Квашеную капусту нужно тщательно просмотреть, рассол слить в отдельную посуду и добавить к нему 2% раствор соли. Затем нужно уложить капусту в банки до «плечиков» и закрыть их крышками. Если Вы используете литровые баночки, то их нужно прогреть 20 минут, трех литровые – 25 – 30 минут. Потом банки нужно закатать. Такая капуста будет храниться при комнатной температуре долгое время.

А теперь рецепт классической квашеной капусты в банках от Юлии Минаевой (Канал «Во саду ли в огороде»).

Желаю Вам всего доброго!

Квашеная капуста — пожалуй, самый простой рецепт сохранения этого полезного овоща. При варке капусты в ней разрушается почти половина такого полезного витамина, как В9 (фолиевая кислота), а вот во время квашения все витамины остаются в целости и сохранности и даже прибавляются! Количество витамина С, например, увеличивается в разы, достигая 70 мг на 100 г, а витамина Р в квашеной капусте в 20 раз больше, чем в свежей. За счёт молочнокислого брожения в капусте образуется большое количество пробиотиков, что приравнивает квашеную капусту к кефиру. Причём кефирного алкоголя в квашеной капусте нет. Рассол от квашеной капусты тоже полезен — он содержит вещества, не дающие углеводам превращаться в жир, и потому он отлично подходит для профилактики гастритов с повышенной кислотностью и становится просто незаменимым помощником для стройнеющих.

В общем, решено — готовим заготовки на зиму из капусты. Квасим капусту! Как и в любом деле, в квашении есть свои правила и тонкости.

Капуста для квашения должна быть поздних и среднепоздних сортов. Ранняя капуста не подойдёт, так как у неё рыхлые кочаны и сильно окрашенные в зелёный цвет листья, кроме того, они беднее сахаром, поэтому процессы брожения идут гораздо хуже.
. Если Вы решили квасить капусту с морковью, то моркови нужно брать в количестве 3% от веса капусты (300 г моркови на 10 кг капусты).
. Соль для заквашивания употребляют обычную крупную, не йодированную!
. Количество соли составляет 2-2,5% от веса капусты (200-250 г соли на 10 кг капусты).
. Для пущей полезности можно использовать морскую крупную соль, но тоже не йодированную.
. Для квашения капусты можно использовать самые разные добавки: яблоки, бруснику, клюкву, тмин, свёклу, лавровый лист. Эти добавки кладут по вкусу.
А теперь о технологии. На самом деле ничего сложного в квашении капусты нет, но если пропустить или проигнорировать хотя бы один этап, то все усилия могут пойти прахом. Приступим.
. Кочаны перед квашением зачищают — удаляют грязные и зелёные листья, избавляются от загнивших и подмёрзших частей, обрезают кочерыжку.
. Капусту можно измельчить, а можно заквасить целыми кочанами (правда, в условиях городской квартиры это вряд ли возможно).
. Морковь очищают и измельчают (можно натереть на обычной тёрке или на тёрке для корейской моркови).

Измельчённую капусту и морковь высыпают на стол, пересыпают солью и активно перетирают руками, добавляя необходимые добавки, до тех пор, пока капуста не пустит сок.
. Подготавливают тару: в бочонок или эмалированную большую кастрюлю уложить на дно капустные листья.
. Уложить капусту в тару. Для этого насыпают капусту слоем 10-15 см и плотно трамбуют. Далее снова насыпать слой капусты и снова утрамбовать, и так до конца.
. Если Вы квасите капусту в большой таре, уложите внутрь капустной массы небольшой целый кочан. Зимой у вас будут очень вкусные голубцы из листьев квашеной капусты.
. Сверху настелить капустные листья, уложить чистую тряпочку, кружок и гнёт.
. Если всё сделано правильно, то через сутки на поверхности должен появиться рассол.
. Наилучшая температура для брожения — комнатная.
. Первый признак правильного брожения — пузырьки и пена на поверхности рассола. Пену следует удалять.
. А теперь — самый важный этап, пропустив который, можно испортить свою капусту. Чтобы избавиться от газов с неприятным запахом, капусту следует протыкать деревянной палкой в нескольких местах до самого дна. Делать это надо каждые 1-2 дня.
. После того, как капуста осядет, груз нужно снять, удалить верхние листья и слой побуревшей капусты. Кружок нужно вымыть горячим содовым раствором, салфетку постирать в воде, а затем в солевом растворе. Салфетку отжимают и накрывают поверхность капусты, кладут кружок и груз меньшего веса. Величина гнёта должна быть такой, чтобы рассол выступил до края кружка.
. Если рассол не появляется, то нужно увеличить гнёт или долить рассол.
. Хранить квашеную капусту нужно при температуре 0 — 5ºС.
. Правильно заквашенная капуста имеет янтарно-жёлтый цвет, обладает приятным запахом и кисловатым вкусом.

Вот несколько рецептов квашеной капусты.

Капуста квашеная с яблоками:
10 кг капусты,
300 г моркови,
500 г яблок,
250 г соли.

Капуста на зиму квашеная с брусникой (клюквой):
10 кг капусты,
300 г моркови,
200 г брусники (клюквы),
250 г соли.
Капуста квашеная с тмином:
10 кг капусты,
500 г моркови,
2 ч. л. семян тмина,
250 г соли.

Капуста квашеная с лавровым листом:
10 кг капуста,
500 г морковь,
2 ч.л. тмина,
¼ ч.л. семян кориандра,
10 горошин душистого перца,
800 г яблок (дольками),
100 г соли.

Ингредиенты:
10 кг капусты,
300-500 г моркови,
10 яблок,
200 г соли,
3 ст.л. сахара.

Приготовление:
Подготовить продукты: капусту очистить, удалить повреждённые листья, удалить кочерыжки, нашинковать, морковь очистить, натереть на тёрке, яблоки нарезать дольками и удалить семенные коробочки. Перетереть капусту с солью, добавить морковь и сахар (при желании можно увеличить количество сахара до ½ стакана). Банки с широким горлышком ошпарить кипятком, выложить дно капустными листьями. Уложить слой капусты в банку, утрамбовать, чтобы капуста пустила сок, затем выложить слой яблок, снова капусту и т.д. Заполнить банку, укрыть листьями, положить чистую салфетку и маленькое блюдечко. На него поставить узкую банку, наполненную водой — это будет наш гнёт. Оставить банки с капустой при комнатной температуре, не забывая протыкать деревянной палкой до самого дна, чтобы вышел газ. По окончании брожения вынести капусту на холод.

Капуста квашеная в банках оригинальным способом

Ингредиенты:
15-16 кг капусты,
1 кг моркови.
Рассол:
10 л воды,
1 кг соли.

Приготовление:
Приготовить рассол, растворив соль в горячей кипячёной воде. Капусту нашинковать, морковь натереть. Смешать капусту и морковь, не перетирая. Опускать смесь частями в остывший рассол и держать в нём 5 минут. После этого вынуть капусту из рассола, отжать и переложить в другую посуду. Таким образом «перемыть» всю капусту. Затем уложить капусту в банки, утрамбовывая, закрыть полиэтиленовыми крышками и оставить на ночь при комнатной температуре. На следующий день вынести в холод. Если в банках недостаточно рассола, то его следует долить.

Капуста квашеная по-быстрому

Ингредиенты:
2 кг капусты,
2 шт. моркови,
250 г клюквы,
200 г винограда,
3-5 яблок.
Рассол:
1 л воды,
1 стакан растительного масла,
1 стакан сахара,
¾ стакана уксуса,
2 ст.л. соли,
1 головка чеснока.

Приготовление:
Приготовить рассол — смешать все ингредиенты, нарезанный чеснок, довести до кипения и кипятить 2-3 минуты. Нашинковать капусту, натереть морковь. Уложить слоями в ёмкость капусту, морковь, виноград, клюкву, яблоки, снова капусту и т.д. Залить капусту рассолом, положить гнёт. Через 2 дня капуста будет готова.



Ингредиенты на 3-х литровую банку:

2-2,5 кг капусты,
3 ст.л. соли,
3-5 горошин чёрного перца,
3-5 горошин душистого перца,
4-5 ст.л. сахара,
2-3 бутона гвоздики,
1-2 ст.л. тёртого хрена,
чеснок, чёрный молотый перец — по вкусу,
1 некрупная свёкла.

Приготовление:
Положить на дно банок с широким горлышком перец горошком, гвоздику, тёртый хрен. Уложить в банку слоями крупно нарезанную капусту, нарезанную тонкими ломтиками свёклу, подсаливая и посыпая сахаром, и добавляя чеснок и молотый перец. Каждый слой утрамбовать толкушкой. Поставить банки в тёплое место на 3 дня. Под банки поставить тарелки, так как жидкость при брожении может вытечь. Не забывайте протыкать содержимое деревянной палочкой. По окончании брожения вынести капусту на холод.

Ингредиенты:
1 кочан капусты,
1-2 свёклы,
2 шт. моркови,
3 шт. сладкого перца,
4 зубчика чеснока,
10-15 горошин чёрного перца,
пучок укропа,
1 ст.л. сахара,
1 ст.л. лимонной кислоты,
соль — чуть более чем по вкусу.

Приготовление:
Кочан капусты разрезать на 8-12 радиальных частей, свёклу и морковь нарезать тонкими пластинками, перец — соломкой, чеснок и укроп измельчить. Уложить в ёмкость слоями, пересыпая солью и сахаром. Вскипятить воду в достаточном количестве, насыпать в капусту лимонную кислоту и залить кипятком так, чтобы вода покрыла капусту. Накрыть чистой салфеткой, положить гнёт. Капуста готова через 3-4 дня.

Капуста квашеная острая со свёклой

Ингредиенты:
2 кочана капусты,
2 свёклы,
2 головки чеснока,
1 стручок горького перца,
2-3 корня петрушки,
2-3 корня хрена,
соль по вкусу.

Приготовление:
Кочан капусты разрезать на 8 частей. Свёклу натереть, чеснок измельчить, корень петрушки и хрена настругать, горький перец мелко нарезать. Сложить капусту в ёмкость, пересыпая измельчёнными овощами и солью, залить горячей кипячёной водой и поставить в тазик, куда будет выливаться лишний рассол. Оставить на трое суток в тепле, прокалывая деревянной палкой. По окончании брожения вынести на холод.

Ингредиенты:
10 кг капусты,
3-4 свёклы,
300-600 г острого перца,
600-1000 г зелени сельдерея,
10-15 лавровых листьев,
60-120 г зелени петрушки.

Приготовление:
Кочаны капусты разрезать на 6-8 частей, уложить в тару, перекладывая ломтиками свёклы, крупно нарезанной зеленью и перцем. Залить горячим рассолом (на 10 л воды — 500-700 г соли). Оставить на 2-3 дня в тепле. Затем вынести на холод.

Капуста на зиму быстрого засола

Ингредиенты:
10 кг капусты,
200-250 г соли.

Приготовление:
Нашинкованную капусту смешать с солью, плотно уложить по 3-х литровым банкам и залить холодной кипячёной водой. Оставить при комнатной температуре на 3 дня. Иногда прокалывать капусту палочкой. Через 3 дня слить воду, растворить в ней сахар из расчёта 1 стакан сахара на банку, снова залить капусту и поставить в холодильник.

Капуста квашеная острая

Ингредиенты:
8 кг капусты,
100 г чеснока,
100 г корня хрена,
100 г зелени петрушки,
300 г свёклы,
1 стручок горького перца,
4 л воды,
200 г соли,
200 г сахара.

Приготовление:
Нарезать капусту крупными ломтями, смешать её с тёртым хреном, мелко нарезанным чесноком, кубиками свёклы, мелко нарубленной петрушкой и горьким перцем. Приготовить рассол — вскипятить воду, добавить соль, сахар, прокипятить, остудить. Залить рассолом капусту, положить гнёт, выдержать двое суток в тепле, затем вынести в холод.

Нашинковать капусту, морковь, свёклу (можно без неё), добавить лавровый лист, семена тмина, посолить по вкусу, всё перемешать. На дно тары положить ¼ буханки ржаного хлеба, заложить нашинкованные овощи. Несколько раз проколоть деревянной палочкой. Через 3 дня вынести на холод.

И напоследок — рецепт квашеной капусты без соли по рецепту В.Зеланда (автора книги «Живая кухня»). Этот рецепт преобразован автором из базового рецепта квашеной капусты по Брэггу. Интересно то, что для квашения подойдёт и зелёная капуста.

Квашеная капуста без соли (рецепт сыроеда)

Ингредиенты:
2 кочана капусты,
700-800 г моркови,
½ ч.л. молотого острого перца (кайенского, чили),
60 г сухой молотой паприки.

Приготовление:
Капусту крупно нарубить, грубые стебли выбросить, кочерыжку также нарезать. Морковь нарезать кружочками. Смешать в посудине вместе с приправами, но не мять. На дно двух трёхлитровых банок положить по капустному листу, плотно набить банки капустой, утрамбовывая деревянной толкушкой так, чтобы до горлышка оставалось 10 см, закрыть сверху капустными листьями. Залить капусту чистой питьевой или дистиллированной водой так, чтобы покрыть листья. Поставить в банки пластиковые бутылки, наполненные водой, в качестве груза. Груз должен быть достаточно сильным, чтобы вода покрывала верхние листья капусты. Оставить в тёплом месте. Через некоторое время вода в банках начнёт подниматься. Если она начнёт переливаться через край, груз лучше убрать или уменьшить. Каждые несколько часов придавливать капусту, чтобы вышел избыток углекислоты. Через 2 дня поставить капусту в холодильник. Где она должна постоять ещё неделю. Следите за тем, чтобы вода всегда покрывала листья.

Выбирайте и готовьте капусту любым способом — квашеная капуста в любом случае принесёт вам только пользу. Обязательно загляните в наши пошаговые рецепты заготовок на зиму . Удачных заготовок!

Лариса Шуфтайкина

Квасить капусту наши предки умели с давних времен. И зачастую квашеная капуста была практически единственным источником витаминов в зимнее время, ели её каждый день. Самый простой рецепт квашения капусты — нашинковать кочан, перетереть с небольшим количеством соли и поставить под гнет, через несколько дней капуста квашеная в собственном соку готова. По мере возможности хозяйки добавляли в нее клюкву, бруснику, морковь, яблоки, тмин. Узнаем подробнее о полезных свойствах капусты и о том, как правильно ее квасить.

Польза квашеной капусты

Удивительно, но квашеная капуста считается более полезной , чем свежая. При квашении в овоще увеличивается количество витаминов, которые значительно лучше усваиваются. Так что квашеная капуста — прекрасный доступный источник витаминов. Замечательные полезные свойства квашеной капусты отмечают даже врачи. Она влияет на работу желудочно-кишечного тракта, печени, способствует повышению иммунитета благодаря высокому содержанию витамина С и не только. В квашеной капусте содержится много фолиевой кислоты и витаминов группы В, почти все минералы, что в совокупности способствует нормализации обменных процессов и укреплению сосудов. Капуста выводит холестерин и благодаря наличию редкого витамина U способствует эффективной регенерации слизистой желудка. К тому же, квашеная капуста — природный онкопротектор.

Описывать полезные свойства квашеной капусты можно долго, среди них:

  • улучшение работы ЖКТ (витамин U) и нормализация уровня холестерина,
  • капуста укрепляет нервную систему (витамины группы В),
  • укрепление иммунитета (витамин С) и профилактика заболеваний — средство от авитаминоза (антиоксиданты и витаминно-минеральный состав),
  • снижение веса (тартроновая кислота) и нормализация обмена веществ (йод, никотиновая кислота),
  • снижение показателей сахара в крови (мало углеводов, много клетчатки) — порция квашеной капусты 100-120 грамм в день снижает риск сахарного диабета 2-го типа на 14% и затормаживает угасание умственных способностей на 11 лет,
  • антигистаминное (витамин U), бактерицидное, противовоспалительное, обезболивающее и тд.

Важнейшие полезные свойства квашеной капусты — противоонкологические. Исследования показали, что употребление квашеной капусты способствует предотвращению деления раковых клеток. Вещества, содержащиеся в квашеной капусте, особенно интенсивно воздействуют на злокачественные опухоли кишечника, молочных желез, легких. Например:

  • три порции квашеной капусты в неделю позволят сократить риск рака лёгких на 33-72% и рака простаты у мужчин на 41%;
  • четыре порции квашеной капусты в неделю окажут неоценимую пользу для сокращения риска развития рака груди почти на 50%;
  • пять порций квашеной капусты в неделю роявляют свои полезные свойства в снижении риск рака мочевого пузыря на 51% и существенно сокращают риск рака толстой и прямой кишки, а также язвенной болезни и связанного с ней рака желудка.

Все полезные качества квашеной капусты сохраняются на протяжении десяти месяцев со дня приготовления. Любите квашеную капусту, и готовьте ее сами!


Как правильно приготовить квашеную капусту

Для приготовления квашеной капусты нужно знать несколько кулинарных секретов и иметь хороший рецепт. Мы расскажем, как сделать квашеную капусту хрустящей, полезной, вкусной. Процесс квашения капусты следует контролировать, для этого подготовьте тонкие деревянные палочки и прокалывайте ими капусту для отхождения углекислого газа и создания оптимальных условий для молочнокислых бактерий, а доступ кислорода будет губительным для листерий и других патогенных бактерий.

Приготовьтесь к процессу квашения капусты заранее, подготовьте все необходимое. Используемые в процессе подготовки капусты к квашению кухонные приборы, ножи, сечки и всё остальное должно быть чистым. Чтобы полезные свойства квашеной капусты раскрылись максимально, нужно соблюдать ряд правил:

  • когда квасить капусту
Квасят капусту осенью. На огородах кочаны срезают после того, как ночная температура стабильно начнет опускаться ниже 0 С. Обычно это случается в первой половине октября. Впрочем, квасить капусту можно всю зиму, кочаны пролежат до самой весны, если они плотные и сухие. Однако именно первая капуста самая вкусная, самая хрустящая, самая ароматная.
  • как выбрать капусту для квашения

Выбирайте поздние сорта капусты, кочан должен быть плотным и слегка похрустывать при нажатии. Лучше выбирать кочан самый белый, какой найдете- такая капуста будет хрустеть. Обязательно нужно обратить внимание на кочерыжку: она тоже должна быть плотной, сочной.
Для квашения капусты берите только цельные, чистые кочаны, без малейших загрязнений землёй, слизняками или гусеницами, верхний слой листь-ев безжалостно удаляйте до чистого вилка.
Если выбираете капусту поздней осенью, то проверьте, чтобы она была не подмерзшей.
Из двух одинаковых по размеру кочанов выбирайте тот, что потяжелее. Чем плотнее листья, тем вкуснее получится закуска.

  • в чем квасить капусту

Лучше всего капусту квасить в деревянной кадке, также можно использовать стеклянную, в крайнем случае — эмалированную посуду.
Пластиковые ведра капусте противопоказаны. Так же, как и емкости из нержавейки.
В качестве гнета подойдет камень (чистый) или банка с водой. Металлические предметы на капусту лучше не ставить.

  • сколько соли класть и какую соль использовать

Для квашения капусты лучше использовать крупную каменную соль. Капусте противопоказана йодированная соль, она делает ее мягкой. Сколько класть соли в квашеную капусту — дело вкуса. В среднем кладут 1-2 ст.л. соли на 1 кг капусты.

  • как нарезать капусту

Обычно капусту мелко шинкуют, причем шинковка не должна быть слишком тонкой, иначе капуста получится мягкой. Кочерыжку перед нарезкой надо удалить, но можно ее накрошить отдельно и добавить к капусте, дело в том, что в кочерыжке содержится много полезных веществ. Это имеет смысл, если капусту вы вырастили собственноручно, и вы уверены, что кочерыжка не накопила нитратов и химикатов. Иногда капусту режут квадратиками, а иногда просто разрезают кочан на четвертинки или половинки.

  • как квасить целую капусту
Кочан, как целый, так и его части, вкусно просаливается в массе нашинкованной капусты.
Чтобы кочан равномерно просолился, надо на кочерыжке сделать крестообразный надрез.
Листья от квашеного кочана можно использовать для голубцов.
  • чтобы капуста хрустела

Простой способ сделать капусту плотной и хрустящей — перед засолкой облить ее холодной водой.
Еще один способ добавить квашеной капусте хруста — добавить к ней немного корня хрена.
Добавленная к капусте морковь также прибавит ей хруста и делает капусту еще вкуснее.

  • что добавить к квашеной капусте

Идеальная пара для капусты — морковь, она делает капусту хрустящей и ароматной. Душистый и черный перец, тмин, семена укропа, гвоздика, острые свежие перчики будут отличным дополнением к квашеной капусте. Клюква, брусника, яблоки, сливы приятно и полезно разнообразят вкус квашеной капусты. Свекла, добавленная в капусту, придаст ей рубиновый цвет и немного необычный вкус.

  • Клюкву. Обогатит ваши заготовки витаминами группы В, калием, йодом и магнием. А вот аскорбинки вопреки распространённому мнению клюква не добавит. По содержанию витамина С клюква уступает капусте. Но зато в клюкве много редкого витамина РР, без которого большая часть аскорбинки попросту не усваивается. Так что с клюквой капуста станет однозначно полезнее!
  • Хрен. Содержит калий, фосфор, железо, медь и натрий. Вещества, входящие в состав хрена, способствуют перевариванию тяжёлой пищи, так что квашеная капуста с хреном — лучший гарнир к свинине или холодцу.
  • Бруснику. В этой ягоде много калия, который поддерживает сердце и бережёт сосуды. К тому же брусника обладает лёгким мочегонным эффектом, что помогает избежать отёков после поедания солёной капусты. К тому же брусника увеличит срок хранения квашеной капусты — органические кислоты, которых много в этой ягоде, не дадут заготовке заплесневеть.
  • Яблоки. Содержат витамины группы В и некоторое количество железа. Но главное достоинство яблок — способность устранять вздутие живота и бурление в кишечнике. А и то и другое — не редкость, если переборщить с квашеной капустой.
  • Свёклу. В ней много пищевых волокон, которые усиливают моторику кишечника, то есть служат для профилактики запоров. К тому же свёкла содержит вещество под названием бетаин, который улучшает работу сердца и защищает печень.
  • как добавить морковь в квашеную капусту

Морковь нужно не тереть на обычной тёрке, а нарезать очень тонкой соломкой или использовать тёрку для корейской моркови. Тертая морковь придаст капусте розоватый цвет, а если морковь тонко нарезать, то квашеная капуста останется белой.

  • полезные советы

Листья хрена, которыми укрывают капусту, защищают её от плесени и болезней.

Когда чистите кочан, надо с него снять несколько больших листов — ими выстилают дно кастрюли для квашения и закрывают капусту сверху.

Как следует утрамбуйте капусту, когда закладываете её квасить, так она даст больше сока. Но соблюдайте меру, если перестараться, то капуста будет мягкой.

В процессе брожения капусты её нужно проткнуть деревянной палкой или спицей в нескольких местах: выйдут лишние газы, исчезнет неприятный запах.

Через неделю капусту уже можно есть, но лучше ещё недельку поквасить в прохладном месте (при температуре 12-15 °С).

Как правильно хранить квашеную капусту

Хранить квашеную капусту нужно в холодном месте. Оптимальная температура хранения — около нуля градусов. Квашеную капусту нельзя замораживать при хранении — она станет мягкой. Также капуста может испортиться из-за перепадов температур. Если температура будет высокой, то капуста начнет усиленно бродить. Обязательно следите за тем, чтобы рассол покрывал капусту, иначе она будет темнеть и портится.

Самая лучшая тара для хранения — деревянная. В стеклянной витамины сохраняются несколько хуже. А вот от эмалированных кастрюль лучше отказаться — в них полезные вещества долго не задержатся.

В ходе закваски в капусте увеличивается количество витаминов.


Рецепты квашеная капуста

  • Капуста квашеная с клюквой


кочан капусты (3 кг), морковь — 150 г, клюква (свежая или сушеная) — 70 г, соль — 100 г, перец — по вкусу

Капусту очистить и нашинковать. Морковь очистить и нашинковать или натереть на терке. Смешать капусту с морковью, посолить и поперчить по вкусу. Все хорошо помять руками до появления сока. Добавить клюкву и снова перемешать.
Пересыпьте все в подходящую емкость и сверху поместить груз. Время от времени необходимо протыкать капусту острой палочкой до самого дна, чтобы избавить капусту от неприятного запаха. На приготовление такой капусты требует около 10 дней.

  • Квашеная капуста с болгарским перцем

Ингридиенты для квашеной капусты:
3 кг белокочанной капусты, 200 г моркови, 200 г болгарского перца, 7 горошин черного перца, 5 лавровых листиков,
3 ст.ложки соли
Способ приготовления квашеной капусты:

Капусту и морковь очистить и нашинковать. Болгарский перец очистить от перегородок, семян и нарезать соломкой. Все соединить, добавить специи и тщательно перемешать. Выкладываем капусту в емкость под пресс и оставляем на 3-4 дня при комнатной температуре. Несколько раз в день нужно протыкать капусту, чтобы выходил газ. Для долгого хранения квашеную капусту нужно переложить в банку, утрамбовать, сверху залить получившимся соком и убрать в холодильник.

  • Капуста квашеная по-русски


11 кг свежей капусты, 400 г моркови, 250 г крупной соли. Можно добавить 0,5 кг яблок (лучше антоновку) и по вкусу — семена тмина, укропа или аниса.
Способ приготовления квашеной капусты:
Срежьте все листья до белых, плотно прилегающих друг к другу.
Порежьте их тонкой соломкой или «квадратиками». Добавьте немного соли, перетрите капустой, чтобы стала чуть влажной.
На дно чистой посуды насыпьте немного ржаной муки, поверх — целые листья. Потом слой капусты, соль и шинкованная морковь. Можно добавить яблоки и семена пряных растений. Всё утрамбуйте. Когда заполните ёмкость, сверху положите листья капусты, 3-4 слоя марли и стерильную тарелку под гнёт (его вес 15% от массы капусты).
Температура брожения — 15-22 °С.
Образующуюся пену удаляйте и 1 раз в 1-2 дня прокалывайте капусту до дна тонкой деревянной палочкой, предварительно ошпарив её кипятком. Когда рассол станет светлым, а вкус будет без горечи, она готова.
Поставьте капусту в холодное место (идеально 0-3 °С), рассол должен всегда покрывать её. Если будет плесень (это бывает), уберите её и ошпарьте кипятком тарелку и гнёт.

  • Капуста, квашенная с острым перцем

Ингридиенты для квашеной капусты:
1 кочан капусты, 2 моркови, 1 ст. л. сахара, 2 ст. л. соли, 1 красный острый перец
Способ приготовления квашеной капусты:
Капусту тонко нашинковать. Перец мелко нарезать. Морковь натереть на терке. Перемешать капусту с перцем и морковью. Плотно уложить смесь в трехлитровую банку, не доходя до горлышка примерно 6 см. Сверху положить соль и сахар, влить столько холодной кипяченой воды, чтобы только покрыть капусту. Поставить банку в глубокий поддон и оставить бродить на три дня. Время от времени прокалывать содержимое банки спицей.

  • Капуста квашеная без соли

Ингридиенты для квашеной капусты:
Мед — 2 ст. л., перец болгарский — 2 шт., капуста — 1 коч., чеснок — 4 голов., хлеб ржаной — 5 шт., морковь — 2 шт.
Способ приготовления квашеной капусты:
Капусту очистить и тонко нарезать. Хорошо помять, чтоб слегка пустила сок. Очистить чеснок, мелко нарезать и перемешать с капустой. Морковь и перец вымыть, нарезать морковь соломкой, а перец квадратиками. В посуду для квашения положить ржаные сухарики и половину меда. Потом — слой капусты и его умять (толщина слоя в умятом состоянии — примерно 5 см), потом прослойку овощей (толщина слоя в умятом состоянии — примерно 1 см). Так заполнить всю банку, сверху залить остатками меда. Капусту оставить пои комнатной температуре на неделю. Каждые сутки прокалывать спицей. Когда приготовится — хранить в холодильнике.

  • Квашеная капуста по классическому рецепту

Ингридиенты для квашеной капусты:
Капуста, каменная соль, тмин, морковь, яблоки, брусника.
Способ приготовления квашеной капусты:
Капусту нашинковать, яблоки и морковь нарезать соломкой. Капусту укладывать в ёмкость, пересыпая солью, тмином, добавляя морковь, яблоки и ягоды. Каждый ряд нужно уминать до образования сока. Поставить на капусту груз. И дважды в день делать отверстия деревянной спицей, чтобы выходил лишний газ. Через две недели закрыть капустными листьями и потихоньку есть.

  • Капуста в белом вине

Ингридиенты для квашеной капусты:
2-3 кочана капусты, 1 бутылка белого полусладкого вина, 3-4 ст. л. крупной соли.
Способ приготовления квашеной капусты:
Капусту нашинковать, перетереть с солью. Уложить в большую ёмкость, облить капусту белым вином. Утрамбовать капусту, поставить груз, ждать 2 недели, периодически делая проколы деревянной спицей.

  • Капуста в рассоле

Капусту солят и в рассоле. Он может быть горячим и холодным. Капусту режут и несильно перетирают с солью, а потом заливают рассолом с пряностями.


Как выбрать качественную квашеную капусту

В магазине это сделать довольно сложно, так как попробовать капусту не получится. А вкус и запах капусты — главные показатели ее хорошего качества.

  • в магазине внимательно читайте этикетку, в капусте не должно быть уксуса или лимонной кислоты.
  • на рынке обязательно нюхайте и пробуйте и лучше всего найти своего продавца, который выращивает капусту.
  • лучше всего брать капусту из кадки, чтобы ее при вас расфасовывали в пакет, заранее расфасованную капусту лучше не брать — она может оказаться мягкой.
  • цвет должен быть бело-золотистым, иногда с розоватым отливом. Капуста не должна быть серой, темные пятна недопустимы.
  • рассол — немного тягучий, чуть слизистый — это нормально, и признаком некачественного товара не является.
  • при покупке на рынке у незнакомого продавца капусту лучше попробовать. И не покупать не хрустящую капусту.
  • если капуста твердая, но не хрустит — значит ее обрабатывали кипятком, так она быстрее просаливается, но теряет витамины.
  • чем крупнее нарезана капуста, тем больше в ней сохранилось витаминов.
  • вкус у капусты должен быть кисло-соленый, свежий, без признаков плесени или залежалости. Часто капусту еще и подслащивают, но это дело вкуса, да и для готовки такая капуста не подходит.

Квашеная капуста — противопоказания

Не рекомендуется употреблять квашеную капусту при повышенной кислотности, при обострении гастрита и язвы, детям до 5 лет. Будьте осторожны: в капусте содержится много соли и щавелевой кислоты, которая неблагоприятна для почек.

Квашеная капуста — одно из любимых блюд в каждой семье, особенно зимой. Часто мы задаемся вопросом: как сделать квашеную капусту? Многие думают, что для этого понадобится бочка или корыто, но, наверняка, у каждой хозяйки есть большая кастрюля – вот она-то отлично подойдет.

Обязательно тонко шинкуйте капусту – от этого блюдо только выиграет, и тщательно перетрите с солью – здесь вам не помешают мужские руки.

Сколько квасить капусту?

При приготовлении квашеной капусты по традиционному рецепту, время на брожение составляет 3-5 дней в теплом помещении, затем капусту выставляют на холод. Если хочется отведать быструю квашеную капусту, то попробуйте рецепт с горячим маринадом. В этом случае капуста будет готова к употреблению через несколько часов.

Как приготовить квашеную капусту?

Рецепт квашеной капусты очень легкий и быстрый. Советую вам приобрести шинковку, в хозяйстве вещь всегда пригодится, и не только для приготовления квашеной капусты, а для нарезки любых других овощей.

Ингредиенты:

  • белокочанная капуста – 1,5 кг;
  • морковь – 1 шт.;
  • соль – 2 ст. ложки;
  • сахар – 30 г.

Приготовление

Капусту и морковь нашинкуйте или нарежьте мелкой соломкой. Перетрите с солью, добавьте сахар. Сложите в кастрюлю, лучше всего эмалированную, и поставьте под гнет на 5 дней. Ежедневно протыкайте в нескольких местах ножом или деревянной палочкой, чтобы выходили скапливающиеся газы и снимайте сверху пену, которую выделяют бактерии. Держать кастрюлю необходимо в теплом месте, чтобы ускорить процесс брожения. Спустя пять дней капуста должна получиться кисло-сладкая и хрустящая. Перед подачей на стол заправьте растительным маслом и мелко-нарезанным зеленым луком.

Квашеная капуста с яблоками

Традиционно к капусте идут различные добавки: морковь, клюква, яблоки, свекла. Вы можете сделать квашеную капусту с яблоками, добавив при засолке 3-4 яблока из расчета на 1,5 кг капусты. Яблоки надо будет предварительно помыть и, очистив от семечек нарезать ломтиками. Капуста получится сладковатой и понравится не только взрослым, но и детям.

Квашеная капуста со свеклой

При добавлении свеклы к квашеной капусте, вы получите очень красивый салат нежно-розового цвета. А если добавите чеснок, то порадуете семью острой и пикантной закуской.

Ингредиенты:

  • белокочанная капуста – 3 кг;
  • свекла – 1 кг;
  • соль – 2 ст. ложки;
  • вода кипяченная – 1 л;
  • перец черный горошком – 5 шт.;
  • уксус – 1 ст.;
  • сахар – 1 ст. ;
  • лавровый лист – 3 шт.

Приготовление

Капусту очищаем от поврежденных листьев и нарезаем квадратиками. Свеклу очищаем от кожуры и режем тонкими пластинами. Перемешиваем капусту со свеклой и готовим маринад: один литр воды нагреваем в кастрюле, даем закипеть и добавляем черный перец, соль, сахар, лавровый лист. Кипятим на маленьком огне около 10 минут. Затем добавляем уксус и кипятим еще одну минуту. Заливаем капусту со свеклой маринадом, перемешиваем, ставим под гнет. Выстаиваем в теплом месте 3-4 дня, затем перекладываем в бутыля и отправляем в холодильник. Подавать к столу можно как салат, предварительно заправив растительным маслом.

Как видите, приготовить квашеную капусту несложно, немного терпения и на вашем столе зимой появятся витамины, которыми так богато это блюдо. Польза от квашеной капусты огромна: она обладает укрепляющим и противовоспалительными свойствами, содержит витамин С, В, калий, цинк, железо, молочную кислоту. Кроме того, квашеная капуста – низкокалорийное блюдо, да и использовать ее вы можете в косметологических целях, если сделаете маску для лица.

Сколько времени квасится капуста на зиму. Сколько квасится капуста при комнатной температуре. Рецепт быстрого приготовления квашеной капусты в банке

Подскажите, сколько должна кваситься капуста в домашних условиях? Некоторые квасят ее 3-5 дней, а некоторые

  1. При закладке соли 250 г. на 10 кг. капусты (2,5%). Брожение капусты начинается на 2-3 день. каждые 3-4 дня прокалывать до дна для удаления газов. Оптимальная температура+18+20гр. Брожение заканчиваеться за 10-12 суток, в зависимости от обьема.
  2. зависит от температуры. я готовность по вкусу опредяю. когда с неделю стоит, когда 3-5 дней.
  3. капусту как поставите она начнет отделять сок, в это время нужно протыкать капусту до дна палочкой (выходит углекислый газ) , а через несколько дней этот сок начинает «уходить» и верх капусты как бы подвяливается…. все, она готова, закрываете и в холодильник
  4. Сильно зависит от температуры. Вот что пишнт промышленное руководство на этот счет.

    Капуста рубится, смешивается с солью, кладется в сосуд и придавливается гнетом. Затем ей дают перебродить неделю при температуре 16 (от 15 до 20 — от одного дня до месяца) . Хранить квашеную капусту лучше при температуре, близкой к нулю, точнее от 0 до 2, предварительно удалив выделившийся газ прокалыванием или спрессовав, чтобы не горчила.

    Практически как она перестала булькать, то готова.

  5. В стеклянных банках капуста квасится 2 дн при комнатной тем-ре (если больше, то она перекиснет). Нужно протыкать 2 р в день, чтобы выходил воздух и следить чтобы сверху всегда был сок (рассол). На 3-ий день убрать в холодное место.
  6. Кому как нравится. У меня в бочке стоит дома неделю-полторы. После на балкон.
    Еще я читала, что на хранение квсить капусту надо в октябре. В идеале в четверг, в новолуние. Тогда капуста якобы получается отменная!
  7. спасибо за советы.
  8. Все, что написали выше — правильно! А фишка вот в чем — все зависит от объема. Чем больше емкость, в которой Вы квасите, тем дольше время заквашивания. Если в банках — заквасится быстро, за 3 дня. А если большой обьем (в бочке или кастрюле эмалированной 40-литровой) , то до 3-х недель нужно!
  9. Капуста квашенная
    Я режу капусту соломкой, муж морковь пропускает через роторную терку, в нарезанную капусту добавляю соль, морковь, перетираю до образования сока, периодически пробую на соль, сок должен быть чуть солонее, чем нужно. Можно добавить порезанную пластинками антоновку. Все смешиваю в пластмассовом большом тазу, можно (лучше) в эмалированном ведре. Как мкость заполнили не доходя до края см 15-20, кладете большую тарелку или крышку, на нее банку или кастрюльку с водой. Оставляете при комнатной температуре, обычно на следующий вечер начинает появляться пенка. Вот тут не ленимся и регулярно (3-7 раз в сутки) протыкаем капусту деревянной или можно металлической палочкой- вилочкой, снимая гнт, выходит воздух с нижних слоев очень активно, ну и запах соответствующий. У меня обычно за 3-5 дней капуста проквашивается- рассол становится прозрачным, раскладываю по банкам и в подвал гаража. Свекровь в своем доме делала капусту иначе, у них большая бочка стоит в подполе, она туда вс сладывала, перемежая небольшими качанами, разрезанными на половинки и четвертинки, но там капуста совсем другая по вкусу, тк она солится при другой температуре.
    В квашенную капусту перед подачей можно добавлять чуть- чуть сахарку- очень улучшает вкус, ну и лучок, брусничку, масличко и кто чего привык.

    Капуста квашенная в банке
    Мой рецепт прост — шинкую капусту, а морковь тру на терке, набиваю 5-ти литровую банку и заливаю кипящим рассолом в пропорции: на 1 литр кипятка 1 ст. ложку круп. соли и 1 ст. ложку сах. песка. Наливаю рассол так, чтобы он покрывал капусту.
    Ставлю банку в тарелку, чтобы было куда сливаться соку. На след. день протыкаю дер. лопаткой и практически на 3-й день капуста готова.
    Сахар можно заменить медом.

  10. я квашу 3 дня
  11. 3-5 дней капуста будет кваситься, если е в небольшом количестве (например, в 3-литровой банке) залить кипятком. Для этого нашинкованная капуста с морковью солится, в не добавляется (по желанию) чеснок, перец, лаврушка, вс это складывается в емкость, заливается кипятком и оставляется для брожения.
    Традиционно же капусту квасят холодным способом, когда подготовленную с добавками и солью капусту укладывают в емкость, очень плотно утрамбовывают, накрывают чистой тканью и деревянным кружком, на который кладтся т. н. гнт (чистый, ошпаренный кипятком булыжник) . Гнт должен быть таким по весу, чтобы выступивший из капусты сок покрывал е полностью. Брожение действительно будет до 3-х недель. Периодически в процессе брожения на капусте надо выполаскивать холодной водой ткань, круг, камень, очищать от портящегося верхнего слоя, если таковой будет, протыкать капусту насквозь чистой палкой.
    Капусту надо брать для заквашивания обязательно зимнего сорта, иначе будет мягкая и невкусная.
  12. Я держу дома три дня, дольше нельзя, иначе перекиснет! Затем выношу на лоджию. Через неделю снимаем пробу!
  13. от 3 дней до недели, в зависимости от количества и тары. в которой солите

Здравствуйте уважаемые читатели и подписчики блога! Как вы думаете, что самое последние из заготовок обычно делаю я? Конечно же, квашеную капусту. Поскольку самая вкусная капуста, как говорят, должна срезаться с наших огородов при первых заморозках, а это значит, что это приходится на такой временной промежуток как октябрь, или же ноябрь, смотря где вы проживаете.

Без этого сокровища не приготовить ни один , или наваристые щи, которые вся моя семья просто обожает. Поэтому сегодня, эту заметку я посвящаю засолки квашеной капусты на зиму.

Выбирайте любой понравившийся рецепт и делайте это блюдо, ведь оно по сравнению с другими видами заготовок самое простое и быстрое в приготовлении. Минимум усилий, максимум удовольствий от такой работы. А потом ведь можно из нее не только приготовить суп, а также использовать в и в пирожках, я очень люблю еще делать бигус или жарить ее с картошкой.

Это мой самый любимый вариант капусты, так как он приготовлен по ГОСТовской технологии тех времен, а именно 1956 года еще тогда в СССР. Наверно в каждом доме есть такие рецепты, вот и у меня есть такая старинная книжечка, которой я дорожу, так готовят моя мама и бабушка.

Самое главное, что этот вариант совсем не требует от Вас много времени, и немало важно разноообразных продуктов. В нем отлично сочетаются только капуста, морковь и соль. Без всяких приправ и специй, а также без добавления уксуса.

Нам понадобится:

  • капуста — 3 кг
  • морковь — 300 г
  • соль — 75 г

Способ приготовления:

1. Капусту нашинкуйте вручную, или же на специальной терке, в зависимости от того сколько вы собираетесь заготовить.


2. Морковь натрите на крупной терке.

Важно! Согласно ГОСТу моркови берется 10 процентов от всей массы капусты. Поэтому считайте сами на 1 кг капусты это 100 г моркови. Соли берется 2 — 2,5 процента от массы капусты, на 1 кг капусты потребуется 25 г.

Нашинкованную капусту смешайте с солью и хорошо руками разомните ее.

4. После того, как капуста выделила сок и стала блестеть, пришло время смешать ее с морковкой.


5. Теперь переложите всю овощную массу в кастрюлю. Возьмите крышку диаметром меньше, чем сама кастрюля. Положите ее в полиэтиленовый пакет или мешок и прикройте ею капусту.


6. Сверху на тарелку или крышку поставьте гнет. Обычно используется трехлитровая банка с водой.


7. В таком виде капуста должна простоять 3 дня при комнатной температуре.

Важно! Чтобы квашеная капуста получилась вкусной, необходимо выпускать деревянной палочкой углекислый газ. Т.е по поверхности капусты делайте проколы в течение дня несколько раз. А самое главное, если вы не знаете, почему ваша капуста горчит, так вот вам и решение, все из-за этого химического процесса.


Поэтому очень важно, чтобы углекислый газ вышел, и готовое блюдо не горчило.

8. По истечении трех дней поместите капусту в банку или баночки. Но, помните, что нужно сначала руками размешать всю массу еще раз, чтобы вышел до конца углекислый газ.


При помощи специальной воронки разложите по баночкам.

9. Соком, или можно сказать рассолом, маринадом, который выделился, залейте баночки.


10. Закройте капроновыми крышками и уберите в холодильник. Хранить такую капусту нужно в прохладном месте, лучше всего подойдет погреб или холодильник, чтобы не возобновился процесс брожения и готовая квашеная капуста не перекисла.


Вот такой простейший и классный вариант готовки! Приятного аппетита!

Видео: Готовим хрустящую и сочную квашеную капусту в домашних условиях

Подобный вариант приготовления я нашла в этом видео, чтобы вы могли еще раз посмотреть в живую как и что делается. Но, помните еще одну хитрость, если взять много моркови, по неправильным пропорциям, таким как типо на глазок, то результат может вас не много огорчит. Так как, если переложить моркови, то капуста потеряет свою хрустящесть, не будет такой хрусткой и станет мягкой.

Рецепт быстрого приготовления квашеной капусты в банке

Такой легкий и один из лучших вариантов засолки капусты дома очень быстрым и мгновенным способом. Это конечно не за 15 минут, но на третий день можно уже употреблять, представляете?! Для разнообразия и улучшения вкусов добавьте свои любимые специи.

Секрет и суперфишка здесь в том, что будет отдельно готовиться рассол, но не бойтесь в этом ничего трудного нет, все очень просто и легко. Ну и само собой, как только рассол, маринад попадет в капусту начнется то самое явление, под названием брожение или квашение, таким методом я ускоряю этот процесс и дозировка соли будет чуть выше, чем всегда. Вот и вся хитрость науки))).

Нам понадобится:

  • капуста — 2-3 кг на 1 трехлитровую банку
  • морковь — 2 шт.
  • лавровый лист — 2 шт.
  • соль — 4 ст.л
  • семена укропа — по желанию
  • перец — по вкусу


Способ приготовления:

1. Первым делом займитесь подготовительной работой овощей. Хорошо вымойте капусту и морковку.

Далее капусту нашинкуйте или нарежьте ножом, обычно это выглядит примерно как тоненькая соломка, хотя я видела и другие варианты засолки лепестками и кусочками, но мне кажется это не уместно, если использовать для общего употребления куда-то в блюда, хотя все возможно. Смотря для какой цели вы делаете эту заготовку.


2. Следом на терке или при помощи специальной насадки в кухонном комбайне перетрите морковь.


3. Перемешайте капустку с морковкой, не бойтесь мните, масса должна получиться равномерной, чтобы начал появляться сок.



Именно в ней и будет кваситься капуста. Добавьте душистый перец, лавровый лист и семена укропа. Капуста должна лежать в таре достаточно плотно. В данном случае емкость используется 5 литровая.

Важно! Соль берется только каменная, крупного помола, а не мелкая.


Размешайте банку с водой до полного растворения соли. А затем залейте этим раствором капусту. Поскольку все овощи должны полностью быть залиты рассолом, сделайте еще одну такую же банку рассола. Либо можно было взять сразу 2 литровую банку и внести в нее 4 ст.л соли и воды.

6. Ну, вот вода полностью покрыла капусту. Возьмите крышку или пластинку и сделайте груз на нее, поставьте банку с обычной водой. На следующий день, после того, как она сутки простоит в тепле начнется квашение.


И тогда нужно будет при помощи ложки или палочки раздвигать капусту и выпускать газ, чтобы она не горчила. Делать это нужно несколько раз в течение дня. Итак все дни до конца брожения.

7. На третий день она полностью сквасится, газы перестанут выделяться.

Важно! Забыла еще сказать, под любую емкость поставьте еще одну, так как в процессе квашения она дополнительно начнет выделять свой рассол, а значит жидкости прибавится и она побежит.


8. Вот такой еще один интересный оригинальный вариант готовки, пробуйте, очень вкусно! Храните в прохладном месте в холодильнике, чтобы она не стала кислой и ядреной.


Очень вкусная квашеная капуста в 3 литровых банках на зиму

Хотите сделать нежную, сочную и хрустящую капусту? Тогда вот вам это пошаговое описание с фото, как раз в помощь. Рецепт проверенный и надежный.

Нам понадобится:

  • капуста — 1 кочан 2 кг
  • морковь — 2 шт.
  • соль — 2 ст.л с горкой
  • сахар — 1,5 ст.л
  • вода — 1,5 л

Способ приготовления:

1. Первым делом разрежьте капусту напополам, удалите кочерыжку. Нарежьте очень-очень мелко, по крайне мере постарайтесь нарезать именно так.

Важно! Если вы берете молоденькую капусту, то и заготовка от этого будет еще только сочнее и нежнее. Потому что старая капуста имеет свойство быть жесткой.


Далее морковь берите нынешнего урожая, а не старого, чтобы она была сочная. Морковку можно потереть на обычной крупной терке, а вообще лучше на терке для корейской моркови, чтобы вышло тонко. Перемешайте овощи руками, сдавливайте капусту, чтобы она выделила сок.

2. После этого возьмите банку 3 литровую. И утромбуйте при помощи подручных средств, таких как скалка))). Чтобы было в банке максимум капусты с морковкой и минимум воздуха.


3. Сделайте маринад или рассол. На 1,5 литра воды высыпьте 1,5 ст. л сахара и 2 ст.л соли. Размешайте ложкой, или закройте банку с водой крышкой и колбасьте, трясите пока все сухие ингредиенты не растворятся.


4. Залейте этой смесью капусту, прям тоже по максимуму, вот так, как на рисунке. Оставьте в теплом месте, через одни сутки появятся пузырьки. Это означает, что начался процесс заквашивания.


5. Поэтому возьмите и ускорьте этот процесс сами, проткните палочкой или другим предметом, в виде ножа, чтобы выпустить газ. Вы сразу увидите, что рассол опускается.


Такую процедуру в день делайте не реже 3-4 раз. Как пузырики появились, так сразу и протыкайте ее))). По истечении трех дней закройте крышкой и поставьте в прохладное место.

6. Вот такая славная капусточка получилась, потом ее можно заправить растительным маслом и лучком, а в роли украшения использовать укроп. Приятного аппетита!


Квашеная капуста с яблоками

Ну, а этот вариант, прям так сказать богатырь, сразу вспоминается наша Русь и печь у пробабушки. Квасится капуста будет в русской бочке-кадушке, как в старые славянские добрые времена, да еще и с яблочками.

Нам понадобится:

  • капуста — почти 20 кг
  • яблоки сорта Антоновка или Богатырь — 2 кг
  • морковь — 1,5 кг
  • соль — 70 г на 3 кг капусты

Способ приготовления:

1. Мелко нашинкуйте капусту, морковь порежьте на соломку или потрите на терке. Затем в глубокой емкости все перемешайте и внесите соль, хорошо разомните, чтобы выделился сок. Далее поместите в бочку.


2. Следом порежьте яблочки на тонкие дольки. Аккуратно перемешайте, чтобы не повредить фрукты.

Важно! Перед нарезкой яблок хорошо их вымойте и удалите сердцевинки.


3. Затем прикройте крышкой и положите камень или что-то вроде этого.


4. Оставьте в теплом месте, через некоторое время вы увидите пузыри, так и должно быть.

Важно! Главное не прохлопать это момент, потому что, если вы вовремя не уберете пузырьки, то появится неприятный запах и аромат, ну и соответственно вкус.


5. Для этого убирайте гнет и протыкайте палкой капусту.


После трех дней уберите квашеную капусту в прохладное место в погреб или на балкон. А через недельки две ее можно кушать! Ням-ням, просто объедение! Чем дольше она будет стоять, тем она будет лучше проквашиваться.

Капуста, квашеная кочанами

Впечатлены? Я когда впервые попробовала такую штуку, сказала «класс!» Это сербская технология, она легкая и экономная во времени, не нужно ничего крошить, а вот ждать готовности придется намного больше, чем обычно. Потом из такой цельной капусты готовятся голубцы, в Сербии их называют сармой.

Как говорится век живи, век учись, и то правда))). На 20 кг капусты берется примерно 1,5 кг соли. Морковь в данном виде не используется.

Нам понадобится:

  • капуста — 12 кг
  • соль нейодированная- 800 г


Способ приготовления:

1. Вымойте хорошо капусту, удалите плохие загрязненные листики.

2. Вырежите кочерыжки. Возьмите кочан и ножом отрежьте вот это место, как показано.


3. Держите нож немного наискосок, чтобы вырезалось пирамидкой. Всю кочерыжку вы не удалите, только верхушку.


4. Поместите кочан в бак или большую кастрюлю и засыпьте вырезанное место солью. Поступите так со всеми кочанами. И оставьте их в таком виде до завтра, до следующего дня.


5. По истечении этого времени соль немного изменится, она втянет в себя капустную влагу.


6. Теперь разрежьте капусту напополам и поместите в тазик или кастрюлю. На 10 кг капусты берется 0,5 кг соли, из которых 300 г уйдет на заполнение отверстий в кочерыжке и 200-250 г для рассола, залейте тару водой (5 л). Сверху положите гнет (5 кг) и дайте постоять пару дней (2 дня) в теплом месте.

Интересно! Можно положить туда же яблочки, несколько штук.


7. За это время в кастрюле начнутся побулькивания, она станет бродить. Поэтому через два дня слейте рассол в другую емкость. Это делается для того, чтобы рассол обогатился кислородом и брожение шло более активно. Далее поместите опять капусту в этот же перелитый рассол и поставьте гнет. Это процедура делается 1 раз в день. Полностью она будет готова через 2 недели.


8. Храните в погребе и до весны ее нужно будет скушать.

Бонус: Капуста квашеная со свеклой

Экологически чистая и очень вкусная капуста без уксуса со свеклой и морковкой. Ну, просто пальчики оближите, а посмотрите, как она смотрится на тарелочке, просто фантастически красивенько и улетно:

Еще могу посоветовать, у кого совсем мало места в погребе хранить капусту не в банках, а в мешках, но из них нужно будет убрать воздух, специальным прибором, т.е сделать под вакуумом. На этом у меня все, надеюсь теперь вы научились правильно делать капусту квашеную на зиму разными способами.

Приятных вам и вкусных открытий! Всем до встречи! Пока-пока!

Квашеная капуста — пожалуй, самый простой рецепт сохранения этого полезного овоща. При варке капусты в ней разрушается почти половина такого полезного витамина, как В9 (фолиевая кислота), а вот во время квашения все витамины остаются в целости и сохранности и даже прибавляются! Количество витамина С, например, увеличивается в разы, достигая 70 мг на 100 г, а витамина Р в квашеной капусте в 20 раз больше, чем в свежей. За счёт молочнокислого брожения в капусте образуется большое количество пробиотиков, что приравнивает квашеную капусту к кефиру. Причём кефирного алкоголя в квашеной капусте нет. Рассол от квашеной капусты тоже полезен — он содержит вещества, не дающие углеводам превращаться в жир, и потому он отлично подходит для профилактики гастритов с повышенной кислотностью и становится просто незаменимым помощником для стройнеющих.

В общем, решено — готовим заготовки на зиму из капусты. Квасим капусту! Как и в любом деле, в квашении есть свои правила и тонкости.

Капуста для квашения должна быть поздних и среднепоздних сортов. Ранняя капуста не подойдёт, так как у неё рыхлые кочаны и сильно окрашенные в зелёный цвет листья, кроме того, они беднее сахаром, поэтому процессы брожения идут гораздо хуже.
. Если Вы решили квасить капусту с морковью, то моркови нужно брать в количестве 3% от веса капусты (300 г моркови на 10 кг капусты).
. Соль для заквашивания употребляют обычную крупную, не йодированную!
. Количество соли составляет 2-2,5% от веса капусты (200-250 г соли на 10 кг капусты).
. Для пущей полезности можно использовать морскую крупную соль, но тоже не йодированную.
. Для квашения капусты можно использовать самые разные добавки: яблоки, бруснику, клюкву, тмин, свёклу, лавровый лист. Эти добавки кладут по вкусу.
А теперь о технологии. На самом деле ничего сложного в квашении капусты нет, но если пропустить или проигнорировать хотя бы один этап, то все усилия могут пойти прахом. Приступим.
. Кочаны перед квашением зачищают — удаляют грязные и зелёные листья, избавляются от загнивших и подмёрзших частей, обрезают кочерыжку.
. Капусту можно измельчить, а можно заквасить целыми кочанами (правда, в условиях городской квартиры это вряд ли возможно).
. Морковь очищают и измельчают (можно натереть на обычной тёрке или на тёрке для корейской моркови).

Измельчённую капусту и морковь высыпают на стол, пересыпают солью и активно перетирают руками, добавляя необходимые добавки, до тех пор, пока капуста не пустит сок.
. Подготавливают тару: в бочонок или эмалированную большую кастрюлю уложить на дно капустные листья.
. Уложить капусту в тару. Для этого насыпают капусту слоем 10-15 см и плотно трамбуют. Далее снова насыпать слой капусты и снова утрамбовать, и так до конца.
. Если Вы квасите капусту в большой таре, уложите внутрь капустной массы небольшой целый кочан. Зимой у вас будут очень вкусные голубцы из листьев квашеной капусты.
. Сверху настелить капустные листья, уложить чистую тряпочку, кружок и гнёт.
. Если всё сделано правильно, то через сутки на поверхности должен появиться рассол.
. Наилучшая температура для брожения — комнатная.
. Первый признак правильного брожения — пузырьки и пена на поверхности рассола. Пену следует удалять.
. А теперь — самый важный этап, пропустив который, можно испортить свою капусту. Чтобы избавиться от газов с неприятным запахом, капусту следует протыкать деревянной палкой в нескольких местах до самого дна. Делать это надо каждые 1-2 дня.
. После того, как капуста осядет, груз нужно снять, удалить верхние листья и слой побуревшей капусты. Кружок нужно вымыть горячим содовым раствором, салфетку постирать в воде, а затем в солевом растворе. Салфетку отжимают и накрывают поверхность капусты, кладут кружок и груз меньшего веса. Величина гнёта должна быть такой, чтобы рассол выступил до края кружка.
. Если рассол не появляется, то нужно увеличить гнёт или долить рассол.
. Хранить квашеную капусту нужно при температуре 0 — 5ºС.
. Правильно заквашенная капуста имеет янтарно-жёлтый цвет, обладает приятным запахом и кисловатым вкусом.

Вот несколько рецептов квашеной капусты.

Капуста квашеная с яблоками:
10 кг капусты,
300 г моркови,
500 г яблок,
250 г соли.

Капуста на зиму квашеная с брусникой (клюквой):
10 кг капусты,
300 г моркови,
200 г брусники (клюквы),
250 г соли.
Капуста квашеная с тмином:
10 кг капусты,
500 г моркови,
2 ч.л. семян тмина,
250 г соли.

Капуста квашеная с лавровым листом:
10 кг капуста,
500 г морковь,
2 ч.л. тмина,
¼ ч.л. семян кориандра,
10 горошин душистого перца,
800 г яблок (дольками),
100 г соли.

Ингредиенты:
10 кг капусты,
300-500 г моркови,
10 яблок,
200 г соли,
3 ст.л. сахара.

Приготовление:
Подготовить продукты: капусту очистить, удалить повреждённые листья, удалить кочерыжки, нашинковать, морковь очистить, натереть на тёрке, яблоки нарезать дольками и удалить семенные коробочки. Перетереть капусту с солью, добавить морковь и сахар (при желании можно увеличить количество сахара до ½ стакана). Банки с широким горлышком ошпарить кипятком, выложить дно капустными листьями. Уложить слой капусты в банку, утрамбовать, чтобы капуста пустила сок, затем выложить слой яблок, снова капусту и т.д. Заполнить банку, укрыть листьями, положить чистую салфетку и маленькое блюдечко. На него поставить узкую банку, наполненную водой — это будет наш гнёт. Оставить банки с капустой при комнатной температуре, не забывая протыкать деревянной палкой до самого дна, чтобы вышел газ. По окончании брожения вынести капусту на холод.

Капуста квашеная в банках оригинальным способом

Ингредиенты:
15-16 кг капусты,
1 кг моркови.
Рассол:
10 л воды,
1 кг соли.

Приготовление:
Приготовить рассол, растворив соль в горячей кипячёной воде. Капусту нашинковать, морковь натереть. Смешать капусту и морковь, не перетирая. Опускать смесь частями в остывший рассол и держать в нём 5 минут. После этого вынуть капусту из рассола, отжать и переложить в другую посуду. Таким образом «перемыть» всю капусту. Затем уложить капусту в банки, утрамбовывая, закрыть полиэтиленовыми крышками и оставить на ночь при комнатной температуре. На следующий день вынести в холод. Если в банках недостаточно рассола, то его следует долить.

Капуста квашеная по-быстрому

Ингредиенты:
2 кг капусты,
2 шт. моркови,
250 г клюквы,
200 г винограда,
3-5 яблок.
Рассол:
1 л воды,
1 стакан растительного масла,
1 стакан сахара,
¾ стакана уксуса,
2 ст.л. соли,
1 головка чеснока.

Приготовление:
Приготовить рассол — смешать все ингредиенты, нарезанный чеснок, довести до кипения и кипятить 2-3 минуты. Нашинковать капусту, натереть морковь. Уложить слоями в ёмкость капусту, морковь, виноград, клюкву, яблоки, снова капусту и т.д. Залить капусту рассолом, положить гнёт. Через 2 дня капуста будет готова.



Ингредиенты на 3-х литровую банку:

2-2,5 кг капусты,
3 ст.л. соли,
3-5 горошин чёрного перца,
3-5 горошин душистого перца,
4-5 ст.л. сахара,
2-3 бутона гвоздики,
1-2 ст.л. тёртого хрена,
чеснок, чёрный молотый перец — по вкусу,
1 некрупная свёкла.

Приготовление:
Положить на дно банок с широким горлышком перец горошком, гвоздику, тёртый хрен. Уложить в банку слоями крупно нарезанную капусту, нарезанную тонкими ломтиками свёклу, подсаливая и посыпая сахаром, и добавляя чеснок и молотый перец. Каждый слой утрамбовать толкушкой. Поставить банки в тёплое место на 3 дня. Под банки поставить тарелки, так как жидкость при брожении может вытечь. Не забывайте протыкать содержимое деревянной палочкой. По окончании брожения вынести капусту на холод.

Ингредиенты:
1 кочан капусты,
1-2 свёклы,
2 шт. моркови,
3 шт. сладкого перца,
4 зубчика чеснока,
10-15 горошин чёрного перца,
пучок укропа,
1 ст.л. сахара,
1 ст.л. лимонной кислоты,
соль — чуть более чем по вкусу.

Приготовление:
Кочан капусты разрезать на 8-12 радиальных частей, свёклу и морковь нарезать тонкими пластинками, перец — соломкой, чеснок и укроп измельчить. Уложить в ёмкость слоями, пересыпая солью и сахаром. Вскипятить воду в достаточном количестве, насыпать в капусту лимонную кислоту и залить кипятком так, чтобы вода покрыла капусту. Накрыть чистой салфеткой, положить гнёт. Капуста готова через 3-4 дня.

Капуста квашеная острая со свёклой

Ингредиенты:
2 кочана капусты,
2 свёклы,
2 головки чеснока,
1 стручок горького перца,
2-3 корня петрушки,
2-3 корня хрена,
соль по вкусу.

Приготовление:
Кочан капусты разрезать на 8 частей. Свёклу натереть, чеснок измельчить, корень петрушки и хрена настругать, горький перец мелко нарезать. Сложить капусту в ёмкость, пересыпая измельчёнными овощами и солью, залить горячей кипячёной водой и поставить в тазик, куда будет выливаться лишний рассол. Оставить на трое суток в тепле, прокалывая деревянной палкой. По окончании брожения вынести на холод.

Ингредиенты:
10 кг капусты,
3-4 свёклы,
300-600 г острого перца,
600-1000 г зелени сельдерея,
10-15 лавровых листьев,
60-120 г зелени петрушки.

Приготовление:
Кочаны капусты разрезать на 6-8 частей, уложить в тару, перекладывая ломтиками свёклы, крупно нарезанной зеленью и перцем. Залить горячим рассолом (на 10 л воды — 500-700 г соли). Оставить на 2-3 дня в тепле. Затем вынести на холод.

Капуста на зиму быстрого засола

Ингредиенты:
10 кг капусты,
200-250 г соли.

Приготовление:
Нашинкованную капусту смешать с солью, плотно уложить по 3-х литровым банкам и залить холодной кипячёной водой. Оставить при комнатной температуре на 3 дня. Иногда прокалывать капусту палочкой. Через 3 дня слить воду, растворить в ней сахар из расчёта 1 стакан сахара на банку, снова залить капусту и поставить в холодильник.

Капуста квашеная острая

Ингредиенты:
8 кг капусты,
100 г чеснока,
100 г корня хрена,
100 г зелени петрушки,
300 г свёклы,
1 стручок горького перца,
4 л воды,
200 г соли,
200 г сахара.

Приготовление:
Нарезать капусту крупными ломтями, смешать её с тёртым хреном, мелко нарезанным чесноком, кубиками свёклы, мелко нарубленной петрушкой и горьким перцем. Приготовить рассол — вскипятить воду, добавить соль, сахар, прокипятить, остудить. Залить рассолом капусту, положить гнёт, выдержать двое суток в тепле, затем вынести в холод.

Нашинковать капусту, морковь, свёклу (можно без неё), добавить лавровый лист, семена тмина, посолить по вкусу, всё перемешать. На дно тары положить ¼ буханки ржаного хлеба, заложить нашинкованные овощи. Несколько раз проколоть деревянной палочкой. Через 3 дня вынести на холод.

И напоследок — рецепт квашеной капусты без соли по рецепту В.Зеланда (автора книги «Живая кухня»). Этот рецепт преобразован автором из базового рецепта квашеной капусты по Брэггу. Интересно то, что для квашения подойдёт и зелёная капуста.

Квашеная капуста без соли (рецепт сыроеда)

Ингредиенты:
2 кочана капусты,
700-800 г моркови,
½ ч. л. молотого острого перца (кайенского, чили),
60 г сухой молотой паприки.

Приготовление:
Капусту крупно нарубить, грубые стебли выбросить, кочерыжку также нарезать. Морковь нарезать кружочками. Смешать в посудине вместе с приправами, но не мять. На дно двух трёхлитровых банок положить по капустному листу, плотно набить банки капустой, утрамбовывая деревянной толкушкой так, чтобы до горлышка оставалось 10 см, закрыть сверху капустными листьями. Залить капусту чистой питьевой или дистиллированной водой так, чтобы покрыть листья. Поставить в банки пластиковые бутылки, наполненные водой, в качестве груза. Груз должен быть достаточно сильным, чтобы вода покрывала верхние листья капусты. Оставить в тёплом месте. Через некоторое время вода в банках начнёт подниматься. Если она начнёт переливаться через край, груз лучше убрать или уменьшить. Каждые несколько часов придавливать капусту, чтобы вышел избыток углекислоты. Через 2 дня поставить капусту в холодильник. Где она должна постоять ещё неделю. Следите за тем, чтобы вода всегда покрывала листья.

Выбирайте и готовьте капусту любым способом — квашеная капуста в любом случае принесёт вам только пользу. Обязательно загляните в наши пошаговые рецепты заготовок на зиму . Удачных заготовок!

Лариса Шуфтайкина

Квашеная капуста — одно из любимых блюд в каждой семье, особенно зимой. Часто мы задаемся вопросом: как сделать квашеную капусту? Многие думают, что для этого понадобится бочка или корыто, но, наверняка, у каждой хозяйки есть большая кастрюля – вот она-то отлично подойдет.

Обязательно тонко шинкуйте капусту – от этого блюдо только выиграет, и тщательно перетрите с солью – здесь вам не помешают мужские руки.

Сколько квасить капусту?

При приготовлении квашеной капусты по традиционному рецепту, время на брожение составляет 3-5 дней в теплом помещении, затем капусту выставляют на холод. Если хочется отведать быструю квашеную капусту, то попробуйте рецепт с горячим маринадом. В этом случае капуста будет готова к употреблению через несколько часов.

Как приготовить квашеную капусту?

Рецепт квашеной капусты очень легкий и быстрый. Советую вам приобрести шинковку, в хозяйстве вещь всегда пригодится, и не только для приготовления квашеной капусты, а для нарезки любых других овощей.

Ингредиенты:

  • белокочанная капуста – 1,5 кг;
  • морковь – 1 шт.;
  • соль – 2 ст. ложки;
  • сахар – 30 г.

Приготовление

Капусту и морковь нашинкуйте или нарежьте мелкой соломкой. Перетрите с солью, добавьте сахар. Сложите в кастрюлю, лучше всего эмалированную, и поставьте под гнет на 5 дней. Ежедневно протыкайте в нескольких местах ножом или деревянной палочкой, чтобы выходили скапливающиеся газы и снимайте сверху пену, которую выделяют бактерии. Держать кастрюлю необходимо в теплом месте, чтобы ускорить процесс брожения. Спустя пять дней капуста должна получиться кисло-сладкая и хрустящая. Перед подачей на стол заправьте растительным маслом и мелко-нарезанным зеленым луком.

Квашеная капуста с яблоками

Традиционно к капусте идут различные добавки: морковь, клюква, яблоки, свекла. Вы можете сделать квашеную капусту с яблоками, добавив при засолке 3-4 яблока из расчета на 1,5 кг капусты. Яблоки надо будет предварительно помыть и, очистив от семечек нарезать ломтиками. Капуста получится сладковатой и понравится не только взрослым, но и детям.

Квашеная капуста со свеклой

При добавлении свеклы к квашеной капусте, вы получите очень красивый салат нежно-розового цвета. А если добавите чеснок, то порадуете семью острой и пикантной закуской.

Ингредиенты:

  • белокочанная капуста – 3 кг;
  • свекла – 1 кг;
  • соль – 2 ст. ложки;
  • вода кипяченная – 1 л;
  • перец черный горошком – 5 шт.;
  • уксус – 1 ст.;
  • сахар – 1 ст.;
  • лавровый лист – 3 шт.

Приготовление

Капусту очищаем от поврежденных листьев и нарезаем квадратиками. Свеклу очищаем от кожуры и режем тонкими пластинами. Перемешиваем капусту со свеклой и готовим маринад: один литр воды нагреваем в кастрюле, даем закипеть и добавляем черный перец, соль, сахар, лавровый лист. Кипятим на маленьком огне около 10 минут. Затем добавляем уксус и кипятим еще одну минуту. Заливаем капусту со свеклой маринадом, перемешиваем, ставим под гнет. Выстаиваем в теплом месте 3-4 дня, затем перекладываем в бутыля и отправляем в холодильник. Подавать к столу можно как салат, предварительно заправив растительным маслом.

Как видите, приготовить квашеную капусту несложно, немного терпения и на вашем столе зимой появятся витамины, которыми так богато это блюдо. Польза от квашеной капусты огромна: она обладает укрепляющим и противовоспалительными свойствами, содержит витамин С, В, калий, цинк, железо, молочную кислоту. Кроме того, квашеная капуста – низкокалорийное блюдо, да и использовать ее вы можете в косметологических целях, если сделаете маску для лица.

12.09.2016 104 478

А знаете ли Вы, что квашеная капуста на зиму является лучшим методом хранения вкусного овоща? В вареной капусте уже нет и половины фолиевой кислоты, в сравнение со свежей. При квашении сохраняются все полезные микроэлементы, объем которых увеличивается в процессе приготовления. Чтобы вкусно сделать и долго хранить, нужно соблюдать некоторые правила рецепта, иначе хрустящей капусточки не получится…

Когда надо квасить капусту?

Прежде чем приступать к процессу, желательно ознакомиться со многими тонкостями легкого дела, которые позволят приготовить вкусную хрустящую и ароматную капусту. Рассуждений о том, когда можно приступать к засолке для зимнего хранения, достаточно много, но однозначного ответа не имеется.

Раньше капусту начинали квасить, когда начнутся первые заморозки. Именно первый морозец избавляет кочаны от характерной горчинки, потому наши бабушки до сих пор пользуются народными календарями. Данный способ хорошо подходит для тех, у кого и сбор урожая производились на собственном участке. Так можно быть уверенным в качестве выращенного урожая.

Заквасить капусту по лунному календарю или нет, решайте самостоятельно и учитывайте некоторые рекомендации. Самая вкусная капусточка получается, когда квашение происходит на 5-6 день за наступлением новолуния, на растущую луну. Если засолить на убывающую, капуста будет мягкой и перекисшей.

Тара для квашения – что лучше?

Считается, что деревянные бочки (кадки) для квашения являются самой лучшей тарой для засолки овоща, именно в такой посуде капуста будет самой вкусной и хрустящей. К сожалению, в домашних условиях, особенно в квартире, такую тару не разместишь, да и покупать настоящую кадку специально для солений не каждый может себе позволить.

на фото — бочка для квашения капусты на фото — процесс подготовки к квашению капусты

Дома, как правило, хозяйки квасят капусту в эмалированных кастрюлях, широких тазах, трехлитровых или пятилитровых банках, ведрах, и вкус получается ничуть не хуже. Перед началом процесса нужно проверить, чтобы не было различного рода сколов и отслоек на эмали.

Большой популярностью и спросом пользуются пластиковые контейнеры, ведра из-за своей легкости и прочности. Правда, в такой таре капусточка не будет иметь насыщенный сочный вкус. Солить капусту в зиму можно практически в любой домашней утвари, кроме алюминиевых изделий. Дело в том, что в процессе квашения образуется молочная кислота, которая вступает в реакцию с алюминием и окисляет его. В результате, вместо хрустящей и душистой, выходит серая, с металлическим привкусом капуста.

Какую капусту используют для засолки и что еще добавляют?

Для зимнего квашения берут не все сорта и гибриды, необходимо использовать только позднюю и среднепозднюю капусту, — Слава, Арос, Морозко, Арктика F1 и другую. Отличить поздние кочаны легко, они имеют довольно не малые размеры и очень плотные, с достаточно толстыми и грубыми листьями. Ранняя капуста не годится для маринования из-за нежных мягких листочков, которые при брожении станут еще мягче. Хозяйки с опытом советуют брать кочаны больших размеров, отходов гораздо меньше и шинковать удобнее.

на фото — кочан капусты для квашения

Для квашения потребуется капуста белокочанная, морковка и обычная каменная соль (крупная), пропорции следующие – на 5 кг шинкованного овоща берут 100 гр соли и 100-150 гр моркови. Такое количество ингредиентов использовалось с давних времен, поэтому данный рецепт квашения капусты считается классическим. Продукт на выходе получается в меру кислым и ароматным, не слишком соленым.

Для придания пикантного вкуса, домохозяйки при квашении добавляют клюкву, бруснику, яблоки, болгарский перец, укропные семена либо тмина. Как правило, дополнительные ингредиенты используют по вкусу на собственное усмотрение. Не всегда капуста получается хрустящей, поэтому опытные кулинары прибегают к небольшой хитрости, кладут тертый хрен, купленную в аптеке кору дуба в количестве 5-8 гр/кг, которые дадут крепость и отменный хруст.

Проверенный рецепт квашеной капусты

Подготовьте кочаны, удалите верхнюю потертую листву, извлеките кочерыжку. Отмерьте необходимое количество крупной соли и других добавок. Морковь моют, чистят, режут кольцами или соломкой, трут на терке. Тертая морковка придаст готовой капусте оранжевый оттенок.

Кочан режется на две половинки и более, исходя от размеров и удобства шинковки в дальнейшем. Шинковать следует тоненькой соломкой, располагая нож поперек кочана. Для удобства нарезки используется поварской нож или нож сечка. Последним кухонным инструментом стоит пользоваться осторожно, начинающим домохозяйкам нужно проявить аккуратность, можно легко пораниться. Используя нож сечку, продукт получается довольно мелких рубленых размеров. Не стоит слишком тонко шинковать кочан, узенькие полоски в последствии не будут иметь приятного хруста и крепости.

на фото — нарезка моркови для квашеной капусты на фото — нарезка капусты для квашения

Нашинкованную капусту складывают в большую чашку (емкость для квашения будет отдельной) и солят, добавляют морковь, перемешивают руками до выделения сока. Размещают в тару для квашения (банки, ведра, тазики и др.) небольшими слоями, тщательно утрамбовывая рукой либо деревянной толкушкой до образования сока. Когда один слой будет уложен, сверху выкладывают дополнительные ингредиенты (клюкву, укроп, бруснику и т.д.). Чередуя слои, наполните тару полностью, до самого верха.

На уложенную капусточку выкладываем чистые листья от кочанов, которые остались при чистке, сверху ставим груз. Используйте широкую тарелку или блюдо, переверните дном вверх, положите большой камень или поставьте полную воды, трехлитровую банку. Выделившийся сок из капусты при установке груза не сливают. Если квасите в банках, не закрывайте крышечками, положите просто сверху на горлышко. В процессе квашения, для сбора излишне выделяющегося сока, подставляйте посуду подходящих размеров под контейнеры, банки, тазики.

Сколько дней квасится капуста и как хранить готовый продукт?

Уложенную капусту оставляют в комнате при температуре воздуха +19 °…+22 °С на 3-7 дней, в зависимости от количества и объема тары. Более низкая температура сдерживает процесс кваски, в результате продукция долго киснет либо процесс вообще приостанавливается. Высокий градус смягчит капусту и сильно закислит.

на фото — процесс сквашивания капусты

Чтобы узнать, идет процесс сквашивания, посмотрите на поверхность, образующаяся пена и пузырьки свидетельствуют о правильном протекании процессов. Пену по мере образования убирают. После начала сбраживания капусту необходимо прокалывать ежедневно, используя деревянные ложки (обратной стороной) для выведения образующихся газов. Прокалывают до самого донышка, чтобы избавить капусту от горечи.

Спустя 3-4 дня капуста осядет, количество выделяемого сока уменьшится, значит, продукт готов. Не спешите прятать на хранение, сначала попробуйте на вкус, который должен быть приятным кислым, если все верно было сделано. Пресноватую капусту необходимо оставить кваситься на пару дней до полной готовности.

Квашеную капусту хранить следует при температуре от 0 °…+5 °С. В погребе, холодильнике, подвале, на балконе, лоджии можно сохранить капусту на зиму, если условия будут соответствующие. Еще один способ хранения на долгий период – заморозка квашеной капусты. Расфасуйте в пакеты, уложите в морозильную камеру и используйте по необходимости. Приятного аппетита!

секреты. Сколько квасится капуста при комнатной температуре

Эта народная традиция сохранилась и до наших дней. Квасят капусту, разумеется, по «бабушкиному» рецепту, при этом мало кто вникает в суть процесса — ну квасится себе капуста и квасится. На вопрос: «почему именно так, а не иначе?» с большой долей вероятности вам ответят, что, мол, так положено, так принято. Пришло время расшифровать эти «положено» и «принято» и в деталях рассмотреть технологические шаги процесса квашения капусты.

Чтобы запустить процесс квашения, нужны тепло, соль, особые бактерии и сахар. Последние две «переменные» уже присутствуют в самом продукте, нам лишь остается создать необходимые для реакции условия и добавить соль. Для этого нашинкованную капусту солят, слегка разминают, после чего укладывают в банку, накрывают чистой тканью и ставят сверху гнёт. С одной стороны, эта хитрая конструкция создает анаэробную среду, с другой — выполняет функцию пресса.

Природный сахар способствует выделению молочной кислоты, содержащей те самые бактерии — катализаторы реакции, а соль помогает вытянуть из капусты соки. В естественном рассоле с кислой средой без доступа кислорода они начинает быстро развиваться, а все вредные бактерии погибают. Соли не должно быть слишком много, поскольку она замедляет процесс брожения, но и не слишком мало, иначе капуста будет излишне мягкой. Золотой серединой считается 20-25 грамм соли на 1 кг капусты.

В процессе брожения особа тонкая соломка так или иначе будет всплывать на поверхность. Однако без рассола она быстро портится, поэтому поверх нашинкованной капусты кладут кусок ткани, целые капустные листья или подгоняют подгнетный круг под размер емкости. В любом случае конструкцию пресса нужно продумать так, чтобы капуста всегда была закрыта и находилась под гнётом. Если на поверхности появляется плесень, ее удаляют, а гнёт и капустные листья/ткань промывают и обдают кипятком.

Одна из обязательных составляющих квашения — сахар. Какое-то количество сахара уже содержится в капусте, но если увеличить его количество, можно ускорить квашение. Сделать это можно двумя способами: просто дополнительно положив немного сахара или же добавив к капусте нарезанную морковь, репу, свеклу и другие овощи. При использовании других овощей мы не только увеличиваем содержание природного сахара, но и изменяем вкусовые характеристики конечного продукта. Так, немного измельченных яблок сделают вкус капусты слаще, редька придаст остроту, а если вам не хватает пикантной ноты, можно добавить имбирь, чеснок или острый перчик. Добиться игры контрастов можно также с помощью специй и приправ, например, ягод можжевельника, семян фенхеля или кориандра.

В теплом месте держат капусту 2-3 суток, в зависимости от температуры, а после переставляют на холод, чтобы замедлить микробиологические процессы. Оптимальная температура заквашивания составляет 17-20 °С. Если она выше, капусту нужно вовремя успеть убрать в холодное место: при высокой температуре реакция будет протекать быстрее, и капуста может просто перекиснуть. При брожении при низких температурах во вкусе может появиться горечь.

В период активного брожения выделяется пена и газ. Время от времени пену нужно снимать, а газ выпускать, протыкая капусту несколько раз в день длинным ножом. Если этого не делать, у капусты появится горький привкус, а из-за пены начнет образовываться плесень. Процесс квашения заканчивается примерно через 15 дней.

В холодильнике, в плотно закрытой банке с достаточным количеством рассола капусту хранят 1-1,5 месяца. При более длительном хранении рано или поздно капуста начинает портиться. Не так страшен ее чересчур кислый или горький вкус — такую капусту без опаски можно бросить в щи, как изменение текстуры и цвета. Если капуста приобрела коричневый или розовый оттенок или стала скользкая на ощупь, без колебаний отправляйте ее в мусорное ведро. Заготовленная впрок квашеная капуста не должна простаивать в холодильнике — включите ее в ежедневное меню, таким образом продукт даже не успеет испортиться.

Ну ни как у меня не получается квашенная капуста пыталась делать, то сухая, то какая то горькая была уж много лет как бросила я капусту так переводить) мариновала с чем угодно и по разным рецептам, получалось вкусно, но вот хочу все ж научится квасить! рецептов в инете много, вроде все просто, но уже боюсь) в общем, знающие, кто сам квасит — как вы это делаете???? что за заговоры используете?))))

ОТЧИТЫВАЮСЬ!!!
сегодня попробовали капусту, вкусно, но я чуть пересолила)
буду экспериментировать дальше)
всем спасибо!

Самое главное постоянно протыкать банку с капустой до дна(только осторожно! не повредите стеклянное дно). Протыкать нужно начинать уже с 8 ч квашения. Например, утром нашинковали и утрамбовали очень плотно в банку, а к вечеру можно уже протыкать ввинчивающими движениями. Я протыкаю деревянной ручкой отбивалки мяса.
Делаете так:
Берете примерно 4 кг- 4,5 кг капусты БЕЛОГО(а не зеленого!) цвета и 1 морковь на 3-х л банку.

Шинкуете и пересыпаете солью. 2 столовых ложки каменной соли с хорооошей такой горкой на 4 кг капусты.
Перетирать ничего не надо -все соки смешаются в банке.
Для квашения нужны микробы, которые у вас на руках. Поэтому берем сухую банку и начинаем закладывать капусту руками тщательно ее там утрамбовывая кулаком (не повредить банку). Накладываем капусту и С усилием все приминаем, затем следующую порцию капусты с морковью. Вот тогда будет уже и сок выделяться, если вы тоненькими полосками нарезали капусту. Может быть и мало сначала сока — он чуть попозже выделиться.
Заполняем банку до самых краев,накрываем марлей или ничем и ставим в миску — будет вытекать сок в процессе.
Квасится 2-3 дня (смотря какая температура в комнате,если высокая,то брожение будет быстрее происходить) . Протыкаем 1-й раз через 8 ч, а дальше протыкаем и смотрим на пузыри — если они еще появляются. то капустка еще не приготовилась и идет брожение — она квасится. Жидкость,которая может убежать из банки заливаем обратно (если есть куда заливать — сок должен впитаться) капуста должна еще поквасится с этим соком.
Через 3 дня закрываем крышкой и убираем в холодильник.
Я как то торопилась и рано банку убрала в холодильник. Через 2 дня приехала,открыла банку и увидела пузыри там — значит еще не доквасилась. Я добавила соли чуть сверху и оставила ее на столе в кухне еще на сутки протыкая 3-4 раза в день. чтобы газ выходил. Потом опять в холодильник. Капуста отличнейшая получилась. Так что не бойтесь- оказывается можно корректировать.
Сок очень нужен и его наличие зависит от сорта капусты. Можете долить водичку.как советовали ниже, но я не пробовала. Обычно так намну, что сок выделается сам.

23.10.2016 10:15:27, не боись — главное практика

Как сделать квашеную капусту в домашних условиях.

Квашеная капуста — любимое блюдо в национальной кухне многих стран. В Китае квашеная капуста известна с 3 века до н.э., известно, что ею кормили рабочих, строивших Великую китайскую стену. В Корее также испокон веков готовят кислую капусту, которая по-корейски называется кимчи. Немецкая и австрийская кухни немыслимы без знаменитых свиных ножек с кислой капустой, польская кухня славится бигусом — это блюдо из кислой капусты с различными видами мяса. Румыны любят готовить сармалу — тушеную…

8 продуктов, от которых ты не поправишься.

Ты до сих пор думаешь, что похудеть можно, только изнуряя себя диетами и постоянно голодая? Забудь! Худеть можно, испытывая вполне комфортные ощущения и не отказывая себе в куске… ну, если не хлеба, то какого-нибудь другого продукта. Просто нужно знать, какие именно продукты и блюда не добавляют тебе килограммов. Вовсе ни к чему питаться одной петрушкой – на свете есть и другие низкокалорийные, и, тем не менее, полезные и вкусные вещи. Супы Суп – это жидкое блюдо, которое менее калорийно, чем…

Квашеная капуста — домашняя в собственном соку

Кочан капусты — на 2-3 кг. Морковь — 2-3 шт (небольшие или 1-2 крупные) Соль по вкусу или 15-25г.(1 ст.л без горки или слегка) на 1 кг. капусты

Квашеная капуста для мужчин

Квашеная капуста – это привычный для русского человека продукт питания. Существует множество рецептов ее приготовления и каждый из них по-своему хорош. Квашеную капусту употребляют как гарнир, как самостоятельное блюдо, используют как компонент для отдельных блюд (салатов, супов, и тд). Капуста содержит полезные для организма вещества в огромном количестве, которые сохраняются в ней на протяжении всего срока хранения. Что содержится в квашеной капусте? Когда врачи рекомендуют пить сок…

Обсуждение

В 3-х литровую банку наливаю рассол(на 1литр воды 2 ст.ложки с горкой соли,прокипятить и остудить)шинкованную капусту с тертой морковкой укладываю в банку,упихиваю,чтобы рассол был сверху стоит дня два,можно несколько раз сделать проколы,затем в холодильник и можно кушать.Очень просто и вкусно,получается хрустящая.Банку поставить в тарелку,сок немного убегает.

Забыла написать,что когда появится пена,нужно протыкать капусту (я делаю длинным ножом),как бы проворачивая.А корочку хлеба в банки не класть,она нужна только на момент брожения.Чтобы капуста получалась вкусной,нужен доступ кислорода,если сразу по банкам распихать,то воздуха для брожения будет не хватать,или придется в день по нескольку раз её ковырять.Удобнее в кастрюле.

научите квасить капусту!!!пожалуйста!

Обсуждение

Шинкуете капусточку (берите зимние сорта,она тогда не мягкая получается)- на 3-х литровую банку идет примерно 4 кг,1-2 морковки на крупной терке. Все это перемешиваете с солью, чтобы было солоновато. Все это плотно набиваете в банку, если сока маловато, то доливаете кипяченой остывшей водичкой.Выдерживаете при комнатной температуре дня три. Без крышки, чтобы выходил сероводород,с этой же целью каждый день несколько раз прокалываете капусточку ножом до дна банки и осаживаете.И пробуете. Как только вам понравится- убираете в холодильник. Все.

Нашинковать капусту,
морковку натереть на крупной терке, посолить (не помню точно, на глазок).
Все это дело хорошо помять руками и под пресс на пару деньков.
Затем снять пресс, все взрыхлить, сделать рукой такие дырки глубокинькие, что б горечь выходила, накрыть марличкой и еще постоять так пару дней, периодически взрыхляя. Все вроде.
Но по-моему сейчас еще нельзя квасить, т.н. задушные дни. Кажеться в ноябре где-то, надо у родителей уточнить, так что если надо, завтра скажу. Или может кто из девочек знает:)
Удачи!

в связи с затянувшейся сверх меры кулинарной импотенцией, прошу помощи. Поделитесь навыками, секретами и приемами в простом деле квашения капусты. В чем вы ее квасите, в какой посуде? Надо ли сильно ее «жамкать» руками, много ли класть морквы. Когда как и чем ее протыкать и когда убирать в холодильник.

Обсуждение

ты мою к сожалению не ела:(, но квашу и правда вкусно:). Я от процесса просто тащусь:) Как-то писала тут, кажется в прошлом году, ссыль найду, кину.
Сахар не кладу, квашу в эмалированном ведре.

Вообще не жамкаю, режу, мешаю с морковкой, на 4-х литровую кастрюлю плотно набитую уже готовой резаной капустой — 3 большие морковки. Развожу в 1л холодной воды 3 стол. ложки соли без горки и заливаю этим рассолом капусту, под гнет дня на 3 в тепле, потом протыкаю деревянной палочкой несколько раз, как перестанет пузыриться, перекладываю в банки и в холодильник.

Обращаюсь с просьбой, киньте в меня рецептом, проверенным, солёной капусты, что-чего-сколько, не хочу у бабушек покупать, хочу своей, а то помидоры-могу, баклажаны-могу, да много чего, а капусту-пропорций не знаю:(((Зараее всем премного благодарна.

Обсуждение

квасить капусту по обычному рецепту, а не салатную,еще рано,через 2-3 недели можно.Если интересует скороспелка(готова через 3 дня),то завтра скину.

В смысле, квашеной капусты? Попробую написать, только у меня пропорции очень проверенные временем и, следовательно, в выражениях мер моей прабабушки:)
Капуста на засолку идет только зимних сортов (как правило, «Слава», она еще не поступила в продажу, будет к концу октября). На ведро нашинкованной капусты большая миска натертой моркови (2,5 глубоких тарелки) и 2 горсти каменной соли (Помол № 1). Если соль простая, мелкая, то ее надо поменьше, примерно 1,5 горсти. Соль не должна быть йодированной! Все это перемешать на столе, сильно руками не тереть. Любители добавляют еще 2 стакана клюквы. Потом пересыпать в ведро (эмалированное), закрыть марлей, придавить руками, чтобы выступил сок и прижать грузом (если нет специального круга, то большой тарелкой с банкой воды сверху). Пусть стоит в кухне 3 дня, 2 раза в день надо протыкать ее до дна в нескольких местах (перед процедурой закрыть дверь, так как запах на 2 день уже ну очень капустный:)). Потом выставить на балкон, предварительно попробовав сок: должен быть кислый. Если нет — пусть еще постоит:) Есть в принципе можно уже на 5 день, но настоящую готовность капуста обретает через 3 недели, когда заканчиваются все биохимические процессы.

Кишечник человека: что в нем происходит из-за антибиотиков и консервантов

Обсуждение

А по ТВ много уже передач было о пользе и вреде домашних йогуртов.Поэтому в магазине покупаю обычный йогурт без добавок себе и смешиваю его с ягодами в блендере.Жаль,только ребенок у меня такое не любит

Большое спасибо за статью! я периодически пью покупные йогурты, хоть и знаю что пользы в них по сравнению с домашними очень мало…а теперь вообще окончательно уверилась в том что надо начинать готовить самой!

8 причин употреблять сок квашеной капусты

1) Квашеная капуста и ее сок – настоящий кладезь витаминов: хорошая доза витамина С, витамины группы В, витамин К и очень редкий и ценный витамин U, известный так же как метилметионин. Богаты эти продукты и минеральными веществами: железо, кальций, цинк, магний, селен, йод, калий, фосфор и другие. При правильном заквашивании все витамины сохраняются, а сам процесс закваски дополнительно обогащает продукт органическими кислотами (молочной и уксусной). 2) В процессе сквашивания образуются…

Обсуждение

Вроде же капуста газообразующая…. интересно, может квашеная нет, раз она образует бактерии, которые подавляют патогенную микрофлору, хорошая статья, много полезного узнала для себя.

Я и не знала, что квашенная капуста такая полезная! Приезжая до бабушки в гости всегда отказывалась ее брать на гостинец. Предпочитала салаты из свежих овощей. Думала в них больше пользы. Спасибо вам! Век живи — век учись!

Квашеная капуста для женщин

Это не только пищевой продукт, но лекарство с грядки, помогающее избавиться от множества болезней, укрепить иммунитет и улучшить внешний вид. Из-за большого количества клетчатки капуста может вызвать повышенное газообразование, но нейтрализовать этот эффект можно употреблением капустного сока. Соком капусты издавна лечили многие заболевания, среди которых болезни желудочно-кишечного тракта, верхних дыхательных путей, кожи, авитаминозы. А красавицы по сей день активно применяют капустный сок…

Обсуждение

А я, наоборот, предпочитала салат из свежей капусты. С растительным маслом, морковью, зеленью. Считала, в таком сочетании будет наибольшая польза. Теперь поняла, что квашенная капуста способна тоже принести пользу организму и моему внешнему виду.

Ух ты, я и не знала, что худеть можно от капустного сока, интересненько) Я обожаю капусту, знаю что она очень полезная именно для иммунитета, потому что в капусте очень много столь важного для нашего организма витамина С, а оказывается, что она полезная вообще для всего организма и красоты.

10001раз прошу рецепт квашенной капусты,да знаю что давали и не раз,но я их активно куда-то засовываю,,вкусной и хрустящей.Просьба ссылками не кидаться. А и ещё мариновать капусту и быстросолить я умею

Обсуждение

Я солю в трёхлитровой банке по давнишнему рецепту. Всегда получается отменная хрустящая капуста. Всё очень просто. Шинкуем капусту и нарезаем морковку. Я, например, люблю чтобы было покрупнее порезано, но всё дело вкуса. Далее солим капусту по вкусу и немножко мнём до образования сока. Плотно забиваем банку. Поверх капусты выливаем столовую ложку мёда и заливаем кипятком(сколько влезет, обычно влезает мало:))Оставляем на 3 дня при комнатной температуре, дважды в день протыкаем ножом. Через 3 дня капуста готова.

для хруста очень важно, чтобы соль была не йодированная, мы ее(соль) всегда на сковороде жарили, йод летуч и при нагревании улетучивается. но это если ведро и больше солить, а если кастрюлю на «быстро съесть» то можно и не париться

Друзья подскажите рецепт самой лучшей в вашей жизни квашенной капусты,плиз. Почему то захотелось, 35 лет не понимала этого подукта, а теперь прямо хочется (не беременна))). все что в магазине и на рынке пробовала — ну фу(((

Обсуждение

спасибо друзья))) попробую рецепт Фикуса — исключительно из за малого количества соли. она, #### , мне в организме воду держит(((

интересно, а если смесь прованских трав добавить, что будет?))

Стандарный рецепт (всегда делаю так):
на 10 кг капусты
200 — 500 гр моркови
250 гр соли (каменной, не йодированной)
Порубить, перемять, уложить под гнет, поставить в тепло. Когда пойдут пузыри — протыкать тонкой деревянной палочкой. Когда пузыри прекратятся — значит капуста готова, нужно убирать в холод.
Иногда в капусту можно добавить 25 гр семян тмина или укропа — они предотвращают излишнее брожение.
Клюкву, бруснику, яблоки предпочитаю класть уже в готовую капусту перед подачей на стол.

Пора квасить капусту. Блог пользователя Офигения на 7я.ру

Капуста у нас в этом году на даче выросла великолепная. Рассадой меня одарили соседки, я её посадила, и вся капуста прижилась без лишних усилий. Бабушки-соседки, которые ходят друг к другу пить чай через мой участок, мои старания оценили)) Зима в этом году подзадержалась, ноябрь стоит аномально теплый. Срубленная капуста лежала в домике на даче, пока я в прошлые выходные, наконец, не решила, что пора забрать капусту, укрыть розы и клематисы, посеять под зиму морковку. Сегодня капусту…

Подготовка семян овощей к посадке.

Качество семян играет необыкновенно существенное значение для выращивания большого и качественного урожая овощных культур в оптимальные сроки. Обязательное требование, чтобы состав семян был одного сорта, не менее 90% всхожести и совершенно не имеющий различных примесей других культур. Роль времени созревания культуры. Возьмем например: капусту раннюю высаживают согласно правилам 50-60 сантиметров в междурядье и на 30-40 сантиметров между растениями. Она достигает спелости через 60-70 дней…

Рано или поздно, но это случается почти с любой женщиной.

Капустный пирог:) Для теста: 250 гр. творога (любой жирности) 125 гр. сливочного масла (комнатной температуры) 2 яйца 1 ст.л. сахара 2 стакана муки 1 ч.ложка разрыхлителя + 1 желток и 1 ст.л. молока (для обмазывания) Для начинки: 1 кг. капусты 10-15 гр. сливочного масла 4 яйца отварить укроп 1. Капусту мелко нашинковать, залитьводой, довести до кипения, убавить огонь и оставить на 25-30 минут готовиться под крышкой. 2. Творог, яйца, сахар и размягченное масло хорошо перемешать до…

Делаете ли вы сезонные заготовки?.

Опрос от пользователя Jasmin Осенние заготовки Делаете ли вы сезонные заготовки? да нет И что заготавливаете? овощи фрукты ягоды грибы еще что-то:) Текущие результаты Другие опросы Опросы на сайте www.7ya.ru

Обсуждение

специально для распробовавших;)
капуста наша квашеная:)
берем капусту белокочанную, шинкуем и мнем, добавляем морковь натертую крупно. Складываем плотно в 3л. банку и заливаем это кол-во рассолом (6 стаканов холодной воды, 2 ст. ложки соли). Оставляем на 2 суток при комнатной температуре, периодически протыкаем вилкой. Через 2 суток рассол сливаем, добавляем 100 гр сахара, кипятим, снимаем пену и заливаем обратно в банку, прямо на капусту. Когда остынет — уже можно есть. Я храню в хол-ке или на балконе. Минимум усилий и вкусно:)

в этом году, наверное впервые, у меня так массово случилось что-то приготовить для дальнейшего поедания:) Видимо потому, что все же появится кладовка со стеллажом;)
на данный момент имеем 18 литров лечо (привет рецепту из конфы кулинарной)
4 литра капусты по двум рецептам от мамы
и 2 литра варенья+3 литра компота из яблок благодаря Charlie 😉
о, еще вспомнила, имею килограмм вяленых помидор, уместившихся в баночке грамм на 300-400:) странная вещь. тоже впервые попробовала.
а у вас?

Субботние разносолы. Блог пользователя Менумашка на 7я.ру

Готовлю в выходные на всю неделю холодные закуски.Это наши любимые рецепты для взрослых и детей, и для неожиданных гостей, и для праздничного стола. Печеный болгарский перец 12 крупных перцев сок половинки лимона 1 ч.л. соли 1 ст.л. сахара 3 ст.л. оливкового масла Перцы испечь на максимальной температуре в духовке примерно 20 минут(пока не начнут темнеть).Вынуть, положить в пакет,плотно закрыть и оставить до полного остывания.Очистить от кожицы, аккуратно вытащить серединку,собирая…

Народная мудрость отражается не только в сказках и загадках, в пословицах и поговорках. Опыт, скопившийся за долгие века существования русского народа, вылился в многочисленные народные лекарственные средства, многие из которых очень действенны… При ожогах на повреждённое место рекомендуется положить кусочек сырой тыквы, или разрезанный пополам картофель, или лист алоэ, или смазать это место мёдом. Также при ожоге помогают настои и отвары вероники, коры дуба, плюща, календулы, зверобоя…

Я обычно капусту-морковку шинковала, соль туды, сахар, специи (перец горошком и лаврушку). Хорошенечко капусту мяла, все перемешивала, складывала в эмалированную/стеклянную/дерев-янную посудину, накрывала тканью и под гнет это дело, при комнатной температуре. Ежедневно тряпочку сполскивала, капусту протыкала, чтоб воздух вышел-и дня через 3-4 можно было есть. Минусы этого способа-отсутствие пропорций и длительное ожидание:))) Насчет пропорций в этот раз совсем сдрейфила, прям кажется что…

Обсуждение

В прошлом году здесь давался «бабушкин рецепт»
Очень толковый и технологичный.
Я всегда его ждала, так мне кажется.

Никакого «мять» капусту. Руки тоже надо поберечь. Капустный сок с солью — просто гремучая смесь для них!

Капусту с морковкой шинкуем.
Делаем рассол:
На 2.25 литра воды 125 гр. соли. Растворить соль (я для этого кипячу, но только потом надо остудить). Затем берете горсть капусты двумя руками, окунаете ее в воду, причем рук не сжимаете, чтобы отжать рассол. Наоборот, надо, чтобы он «обволок» все капустинки.
И укладываете в емкость для сОлки (лучше что-нить эмалированное).
Когда вся капуста обработана, взгромождаете сверху гнет и оставляете в тепле на 3-4 дня до готовности. Каждый день снимать гнет, протыкать капусту в неск. местах, чтобы выпустить горчичный газ, и снова под гнет.

По готовности переложить в банку — и в холодильник.

На самом деле прекрасная капуста выходит. И хрустящая и в меру мягкая…
И готовится — проще не бывает.

Спасибо большое тому, кто дал рецепт. Просто свет в конце тонеля.
А то, что за способ: «мните, чтобы дала сок». Тут, извините, кто как считает. Кому-то кажется, что сок уже дан, а кому-то, что надо еще мять и мять…

сахар вроде уже в заквашенную добавляют

Капуста содержит тартроновую кислоту, которая тормозит превращение в организме углеводов в жиры. Наконец, капуста богата клетчаткой, которая благоприятно действует на двигательную активность желудочно-кишечного тракта и способствует выведению из организма холестерина. Готовя блюда из капусты — салаты, супы и т.д., следует помнить, что в результате содержания активных веществ капуста способствует вздутию живота и метеоризму, чего лишена квашеная капуста, в которой витамина С содержится почти столько же, сколько в лимоне. Квашеную капусту называют «северным лимоном». Лекарственная и диетическая ценность квашеной капусты обусловлена тем, что при квашении капусты часть витаминов (С, В2, PP) и других биоактивных соединений переходит в солевой раствор. По мнению многих специалистов, рассол квашеной капусты еще полезнее, чем сама капуста. Например, регулярный прием теп…

В древности с пожарами боролись при помощи багров, лопат, крюков и ведер — средств, мягко говоря, не слишком эффективных. Современному горожанину доступны более технологичные способы спасения от пожара, тем не менее о них мы вспоминаем чаще всего, когда уже слишком поздно.

Беда:-) Свекровь уехала в «круиз», но обещала по возвращении прибыть с инспекцией — пробовать нашу квашеную капусту. А я бумажку с ее рецептом посеяла:-(((((До возвращения свекрови осталась неделя. Спасайте!:-)))

Обсуждение

Мой рецепт- на 2,5-3 кг капусты- 1 литр рассола (2 ст.л. соли, 1 ст.л. сахара, 1 ст.л. укропа семян), 300 г моркови, капусту перемешать с морковью, утрамбовать в кастрюлю или в банку, залить горячим рассолом. Если в кастрюле- под гнет, если в банке, просунуть в банку дырявую капроновую крышку. Почаще какой-нибудь длинной штукой прокалывать капусту, чтобы выходили пузырьки, тогда горчить не будет. Готово через пару дней. У меня почему-то от горячего рассола не сваривается,хрустит

25.10.2001 12:09:41, Nata*sha

Помогите пожалуйста! Очень люблю тушенную капусту, а она у меня ну никак не хочет получаться. Вот и опять сижу над кочаном и думаю как ее победить.

Квашеная капуста — одно из любимых блюд в каждой семье, особенно зимой. Часто мы задаемся вопросом: как сделать квашеную капусту? Многие думают, что для этого понадобится бочка или корыто, но, наверняка, у каждой хозяйки есть большая кастрюля – вот она-то отлично подойдет.

Обязательно тонко шинкуйте капусту – от этого блюдо только выиграет, и тщательно перетрите с солью – здесь вам не помешают мужские руки.

Сколько квасить капусту?

При приготовлении квашеной капусты по традиционному рецепту, время на брожение составляет 3-5 дней в теплом помещении, затем капусту выставляют на холод. Если хочется отведать быструю квашеную капусту, то попробуйте рецепт с горячим маринадом. В этом случае капуста будет готова к употреблению через несколько часов.

Как приготовить квашеную капусту?

Рецепт квашеной капусты очень легкий и быстрый. Советую вам приобрести шинковку, в хозяйстве вещь всегда пригодится, и не только для приготовления квашеной капусты, а для нарезки любых других овощей.

Ингредиенты:

  • белокочанная капуста – 1,5 кг;
  • морковь – 1 шт.;
  • соль – 2 ст. ложки;
  • сахар – 30 г.

Приготовление

Капусту и морковь нашинкуйте или нарежьте мелкой соломкой. Перетрите с солью, добавьте сахар. Сложите в кастрюлю, лучше всего эмалированную, и поставьте под гнет на 5 дней. Ежедневно протыкайте в нескольких местах ножом или деревянной палочкой, чтобы выходили скапливающиеся газы и снимайте сверху пену, которую выделяют бактерии. Держать кастрюлю необходимо в теплом месте, чтобы ускорить процесс брожения. Спустя пять дней капуста должна получиться кисло-сладкая и хрустящая. Перед подачей на стол заправьте растительным маслом и мелко-нарезанным зеленым луком.

Квашеная капуста с яблоками

Традиционно к капусте идут различные добавки: морковь, клюква, яблоки, свекла. Вы можете сделать квашеную капусту с яблоками, добавив при засолке 3-4 яблока из расчета на 1,5 кг капусты. Яблоки надо будет предварительно помыть и, очистив от семечек нарезать ломтиками. Капуста получится сладковатой и понравится не только взрослым, но и детям.

Квашеная капуста со свеклой

При добавлении свеклы к квашеной капусте, вы получите очень красивый салат нежно-розового цвета. А если добавите чеснок, то порадуете семью острой и пикантной закуской.

Ингредиенты:

  • белокочанная капуста – 3 кг;
  • свекла – 1 кг;
  • соль – 2 ст. ложки;
  • вода кипяченная – 1 л;
  • перец черный горошком – 5 шт.;
  • уксус – 1 ст.;
  • сахар – 1 ст.;
  • лавровый лист – 3 шт.

Приготовление

Капусту очищаем от поврежденных листьев и нарезаем квадратиками. Свеклу очищаем от кожуры и режем тонкими пластинами. Перемешиваем капусту со свеклой и готовим маринад: один литр воды нагреваем в кастрюле, даем закипеть и добавляем черный перец, соль, сахар, лавровый лист. Кипятим на маленьком огне около 10 минут. Затем добавляем уксус и кипятим еще одну минуту. Заливаем капусту со свеклой маринадом, перемешиваем, ставим под гнет. Выстаиваем в теплом месте 3-4 дня, затем перекладываем в бутыля и отправляем в холодильник. Подавать к столу можно как салат, предварительно заправив растительным маслом.

Как видите, приготовить квашеную капусту несложно, немного терпения и на вашем столе зимой появятся витамины, которыми так богато это блюдо. Польза от квашеной капусты огромна: она обладает укрепляющим и противовоспалительными свойствами, содержит витамин С, В, калий, цинк, железо, молочную кислоту. Кроме того, квашеная капуста – низкокалорийное блюдо, да и использовать ее вы можете в косметологических целях, если сделаете маску для лица.

Горячая пора для квашения капусты – сентябрь-октябрь. Капуста к этому моменту наливается соком, окончательно готова к процессам консервирования и соления. Зимой квашеная капуста – самый приятный и витаминный продукт, который может предложить нам огород и его хороший урожай.

Чем хороша квашеная капуста?

Плюсов у квашеной капусты – море. И главное ее преимущество совсем не в том, что с помощью закваски можно на зиму и весну сохранить отменный урожай капусты. В свое время квашеная капуста спасла от цинги и других заболеваний, связанных с падением иммунитета, многие народы.

Квашеная капуста, кроме большого содержания витамина С в ней, имеет огромное количество других полезных витаминов, микроэлементов. К примеру, витамин В6 в ней помогает пище скорее усваиваться. Очевидно, поэтому в зимнее время диетологи с удовольствием назначают квашеную капусту своим пациентам в качестве гарнира к белковым мясным и рыбным блюдам.



Никотиновая кислота, содержащаяся в квашеной капусте, стимулирует рост волос, улучшает их состояние, укрепляет ногти, помогает нормализовать работу внутренних тканей и органов человеческого организма.

Кроме множества витаминов в квашеной капусте присутствуют минералы, наиважнейшие для жизнеобеспечения и поддержания нормального здоровья у человека, такие как железо, магний, цинк, калий и другие.

Сквашенную капусту диетологи любят и за большое количество в ней клетчатки, за низкую калорийность продукта (самое интересное, что свежая капуста и то более калорийна, чем квашеная), а еще за наличие в ней ценной тартановой кислоты, которая блокирует превращение пищи в подкожный жирок.

Так что с любых сторон квашеная капуста подходит для питания всем членам семьи, не только насытит, еще и оздоровит. Потому всю свежую капусту, которую не съели за обедами осенью, следует по шустрому заквасить и не пожалеть на это времени, так как зимой сами себе спасибо скажете за этот труд.

Излюбленных рецептов приготовления соленой, а точнее квашеной капусты у всех хозяек много. Данные советы пригодятся, скорее всего, начинающим хозяйкам. Но могут подкорректировать действия на кухне опытных.

Самая вкусная квашеная капуста получается всегда в деревянной бочке или кадке. Увы, сегодня не в каждом доме найдется такая кадушка, потому за неимением лучшего квасить можно в эмалированной посуде или в стеклянной. Не стоит квасить в пластике, и ни в коем случае нельзя заквашивать капусту в алюминиевой емкости, так как ее стенки при соприкосновении с кислотой продукта могут выделять в него вредные элементы.

Следите за количеством соли при закваске. Недостаток соли делает ее мягкой, не хрустящей, и если соли будет слишком много, это придаст капусте не тот вкус, да и полезные молочнокислые бактерии с переизбытком соли из капусты теряются.



Самое рациональное количество соли на каждые 10 килограмм капусты будет в 200 граммов, не больше. Не рубите всю капусту на закваску. Режьте какие-то кочаны на половинки, четвертинки и кладите их между слоями рубленой капусты. Между прочим, в таких четвертинках и половинках, а то и в целом небольшом кочане квашеной капусты содержится большее количество витаминов, нежели в нарезанной.

Не промывайте капусту перед едой. Вы смываете с нее большую часть витаминов. Просто слегка отожмите и положите в тарелку, сколько нужно. Тушить квашеную капусту можно, только имейте в виду, что она теряет многие свои полезные свойства при этом. Не будем говорить уже о том, что ее отваривание витамины и минералы, содержащиеся в ней, вообще убивает.

Проверенный способ заквашивания капусты в рассоле

Личный рецепт заквашивания капусты в рассоле (много лет готовлю на зиму капусту только так и никак иначе – читатели же, конечно, могут воспользоваться своими рецептами закваски капусты).

На каждую трехлитровую стеклянную банку понадобится примерно 2 кг капусты (поздней, которая подходит именно для консервирования), пара морковок, 3 листика лаврушки, тмин, нарезанный пластиками чеснок, горошины черного перца, но можно и без них.

Отдельно готовится рассол. В каждые полтора литра воды (как раз где-то на банку) насыпается по 2 столовые ложки сахара и соли. Соль не йодированная! Рассол нужно закипятить и остудить до комнатной температуры.



Капусту нашинковать удобным методом, морковь натереть на крупной терке. Капусту и морковь с нарезанным чесноком, тмином, лаврушкой, перцем следует смешать аккуратно. Жать руками капусту не надо!

Капуста перекладывается в банку. Сильно давить на нее не нужно. Слегка утрамбовываем и заливаем остывшим рассолом до самого верха. Банку накрываем марлей и ставим в тарелку или тазик на кухонном столе. Тарелка нужна, чтобы сок, вытекающий из банки при брожении капусты, не выливался на стол.

На столе капуста должна постоять 2-3 дня. Оптимальная температура в комнате для ее приготовления – 20 градусов. При жаре и холоде капуста квасится плохо. Через 3 дня закройте капусту пластиковой крышкой и поставьте ее в холодильник. Капусту можно квасить в большом эмалированном тазу (без гнета!), также залив ее полностью рассолом, а потом переложить по стеклянным банкам, когда она приготовится.

Хрустящая и полезная. Как правильно квасить капусту? | КУХНЯ

Существует масса народных примет, связанных с квашением капусты. Якобы ее надо квасить только на растущую луну, в определенные дни недели и только после Покрова (дня Пресвятой Богородицы). Пожалуй, опытным путем можно подтвердить только последнюю народную мудрость. На квашение хорошо подходят овощи поздних сортов.

Каким должен быть вилок?

Вообще белокочанную капусту можно квасить с октября и до весны – пока получиться раздобыть неиспорченные вилки. Главное, правильно выбрать сам овощ. Это должны быть поздние сорта. Точно не прогадаете, если возьмете белые плотные кочаны, приплюснутой формы. Из ранних сортов лучше делать салаты или мариновать, а при квашении такая капуста получается склизкой и совсем не хрустящей.

Для квашения выбирайте белые приплюснутые вилки. Фото: АиФ/ Татьяна Бахтигозина Каждая хозяйка выбирает свой способ шинковки капусты. Сейчас есть масса приспособлений для этого. Например, специальный нож. При его помощи процесс значительно сокращается по времени, кроме того, нашинкованный овощ получается достаточно аккуратным.

Квасить капусту можно в стеклянных банках или большой эмалированной посуде. У последней не должно быть сколов, иначе продукт может окислиться.  

Шинковать капусту удобно специальным ножом. Фото: АиФ/ Татьяна Бахтигозина

 

Классический рецепт квашеной капусты

10 кг капусты

2 кг моркови

10 столовых ложек (без горки) соли

Сначало нужно подготовить ингредиенты. Морковь нужно потереть на крупной терке. Отмерить необходимое количество соли в отдельную емкость. Отелите от кочана капусты несколько больших листов. Половину уложите на дно кастрюли, где будет кваситься капуста.

Перед шинковкой натрите морковь и подготовьте нужное количество соли. Фото: АиФ/ Татьяна Бахтигозина

Теперь начинаем шинковать капусту. Лучше это делать на большой деревянной доске. Как только места на ней остается мало, добавляем к капусте большую щепотку соли и горсть тертой моркови. Прямо на доске перетираем руками, чтобы капуста дала сок. Укладываем в кастрюлю. Так повторяем, пока не закончатся все подготовленные ингредиенты.

Поверх нашинкованной капусты укладываем подготовленные заранее листья. Накрываем все тарелкой. На нее ставим груз (это, например, может быть трехлитровая банка с водой). Если из-за груза емкость не получается закрыть крышкой, обмотайте пищевой пленкой.

Капусту нужно помять руками, чтобы она пустила сок. Фото: АиФ/ Татьяна Бахтигозина

При комнатной температуре капуста будет кваситься от трех до семи дней. Все зависит от того, насколько тепло в помещении. Утром и вечером капусту нужно протыкать деревянной палкой – это может быть лопатка для перемешивания продуктов. Убирать капусту в холодильник нужно, как только она перестанет пузыриться.

Кстати, продукт можно хранить в стеклянных банках. Или разложить в плотные пакеты или контейнеры и заморозить.

Во время квашения утром и вечером капусту надо протыкать. Фото: АиФ/ Татьяна Бахтигозина

Есть квашенную капусту можно в сыром виде, заправив нерафинированным растительным маслом и добавив лука (лучше сладкого ялтинского). Если она получилось слишком кислой, то перед употреблением ее можно слегка промыть под струей холодной воды. Также продукт добавляют в первые блюда (щи, борщи), вторые блюда (бигус), салаты (винегрет).

Чем полезна квашеная капуста?

Когда говорят о полезности квашеной капусты, часто вспоминают, что именно она спасала моряков от цинги в долгих походах. Но при этом те, кто имеет проблемы с желудком опасаются ее есть. И зря, — считают специалисты.

– В квашеной капусте есть всё, что нужно человеку, — рассказывает кандидат медицинских наук, доцент Нина Шибанова. —  Во-первых, это клетчатка, которая помогает поддерживать нормальную микрофлору кишечника, а значит, укрепляет наш иммунитет. В капусте много минералов и витаминов. Того же витамина С больше, чем в лимоне. При ферментации (квашении) в продукте образуются пробиотики, которые помогают при многих болезнях.

Ещё в ней содержится такой компонент, как убихинон, он необходим для энергетического обмена. Когда его не хватает, человек ощущает упадок сил.

Конечно, квашеная капуста содержит кислоту, а значит, может негативно воздействовать при болезнях желудка – язвах, гастритах, эрозиях. Но термическая обработка не разрушает в этом продукте минералов и витаминов, при этом снижает РН, то есть уровень кислотности. И в супах или вторых блюдах её могут есть все.

Как приготовить идеальную квашеную капусту — все дело в температуре!

Кто не любит домашнюю квашеную капусту?

Я уже упоминал, что люблю свежую домашнюю квашеную капусту? Он острый, хрустящий и невероятно вкусный. Когда я была маленькой, я помню, как мой отец покупал в магазине консервированную квашеную капусту и ел ее. Он всегда предлагал мне немного, и я время от времени ела, потому что на вкус были соленые огурцы, а мне нравились соленые огурцы. Но консервированная квашеная капуста мне не понравилась.

Перенесемся примерно на 20 лет вперед, и я вложил деньги в свой первый немецкий кувшин для приготовления квашеной капусты, потому что слышал, что это действительно полезно для организма, и делал все, что мог, чтобы быть здоровым.Следуя рецепту, который прилагался к кувшину, я смог приготовить одни из лучших, самых аппетитных блюд, которые я когда-либо пробовал. Итак, я пристрастился к квашеной капусте домашнего брожения. К счастью, моя первая попытка была зимой, потому что, в то время как я не знал, что получается отличная квашеная капуста, все зависит от комнатной температуры.

Вам также может понравиться:

Все, что вам нужно знать о выращивании Коул-культур

Выращивайте высокопроизводительный сад, Серия 11: «Выращивание капусты до полного генетического потенциала»

Зелень горчицы: что нужно знать перед выращиванием (с рецептом)

Идеальная квашеная капуста всегда при температуре

Зимой и весной я приготовил несколько партий необыкновенной квашеной капусты, но к тому времени, когда наступило лето, температура на улице достигла 90–100 ° F.Несмотря на то, что наш дом из тюков соломы поддерживал комфортную для нас температуру и намного ниже экстремальных температур на улице, в помещении она все еще находилась в диапазоне 80–83 ° F. Так что, когда моя квашеная капуста не расплылась, как обычно, я заподозрил, что что-то не так. По прошествии 3 недель я открыл свой горшок. Я был не в восторге от того, что обнаружил плесневую, слизистую, мерзкую мерзость. Мягко говоря, было обидно. Итак, я провел небольшое исследование, чтобы выяснить, что произошло. Именно тогда я обнаружил, что комнатная температура для заквашивания квашеной капусты должна постоянно находиться в диапазоне 65–72 ° F.Я не пессимист, поэтому не скажу, что летом нельзя варить квашеную капусту. Но вам нужно будет убедиться, что вы можете поддерживать идеальную температуру для этого. Мы живем в средиземноморском климате с прохладной зимой и жарким летом. Мы также живем вне сети. Но не все живут в таком климате или такой ситуации, поэтому, если вы живете в месте, где круглый год поддерживается хорошая прохладная температура, вы, вероятно, могли бы сбраживать квашеную капусту круглый год. Точно так же, если вы живете в жарком влажном климате, но поддерживаете кондиционер в хорошем и прохладном состоянии в течение всего года, у вас, вероятно, тоже не будет никаких проблем.

В нашем средиземноморском климате нам нелегко выращивать капусту летом. Просто становится слишком жарко, поэтому доступность капусты ограничена или равна нулю, если мы выращиваем ее дома. Хорошая новость — капуста всегда в наличии. Обычно на наполнение кувшина уходит около 6 кочанов, поэтому купить капусту в магазине не так уж дорого. В более прохладном климате, где капуста хорошо растет летом, должна быть возможность готовить квашеную капусту круглый год прямо из капусты, которую вы выращиваете в собственном саду.

Я обычно готовлю плотно упакованный галлон квашеной капусты на каждую партию, и она хорошо хранится в холодильнике в течение 2+ месяцев. Я не уверен, сколько еще это продлится, потому что в нашем доме никогда не бывает так долго, пока все не сожрёт.

Вам также может понравиться:

9 простых эффективных пробиотиков, которые можно приготовить дома

Заквашивайте свой корм для более здоровых и счастливых цыплят

Супер простая ферментированная капуста по-ким-чи!

Как приготовить идеальную квашеную капусту домашнего брожения с кувшином или без него

Если вы думаете о том, чтобы попытаться сбродить собственную квашеную капусту, но немного сомневаетесь, стоит ли покупать кувшин из-за цены, есть хороший вариант домашнего приготовления.Попробуйте использовать стеклянную банку для консервирования с пластиковой завинчивающейся крышкой. Вы можете просверлить отверстие в крышке и использовать прокладку, чтобы закрепить устройство для брожения, подобное тем, которые используются для брожения спирта. Шлюз можно купить в Интернете, и они очень дешевые. Вы можете собрать подобное самодельное решение менее чем за 5 долларов, или вы можете, , подобрать Perfect Pickler , который уже собран. Я часто использую этот метод, особенно если я не хочу ждать 3–4 недели с получением глиняной посуды. Этот метод требует около 4 дней брожения вне холодильника, затем его охлаждают еще на неделю и продолжают брожение в холодильнике.Вкус действительно хороший, но не такой, как у настоящей квашеной капусты, ферментированной в квашеной посуде.

Еще одна хитрость, которую я усвоил при приготовлении квашеной капусты, заключается в том, что, когда я готовлю капусту, я обязательно нарезаю ее тонкими ломтиками, а затем добавляю 1-1 / 2 чайных ложки розовой гималайской соли на каждый кочан после того, как измельчаю ее. В соли не должно быть йода, поэтому обычная поваренная соль не подойдет. Йод препятствует росту полезных бактерий. К тому же гималайская соль содержит много полезных минералов.

Сначала я нарезаю капусту ломтиками. Вы можете использовать мандолину, кухонный комбайн или просто нож и разделочную доску. Только убедитесь, что он не коренастый и не однородный по размеру. Однородность обеспечивает хорошую консистенцию готового продукта.

В этот момент я просто засовывал измельченную капусту в кувшин, посыпал ее солью и затем утрамбовывал трамбовку, но соки никогда не выделялись должным образом. После того, как я закончил капусту и положил сверху камни, мне всегда приходилось добавлять рассол и заливать им готовую капусту и камни, чтобы погрузить их в рассол.

Но теперь, когда меня научили опытные производители квашеной капусты, я положил измельченную капусту в большую миску и посыпал ее солью. Затем начинаю месить и втирать соль в капусту. Это не займет много времени, может быть, несколько минут, и вы заметите, как капуста начинает вянуть, когда начинает течь сок. В этот момент я кладу капусту в кувшин вместе со всем выделившимся соком. Повторив это со всеми кочанами (я делаю только по одному), я кладу камни поверх капусты в кувшин и накрываю крышкой на несколько часов.

Вот, сок начинает покрывать камни. Теперь, если необходимо, я все еще наливаю немного рассола, чтобы убедиться, что на камни есть хотя бы 1 дюйм сока / рассола, прежде чем я закрываю крышку в последний раз и наливаю воду в резервуар кувшина, чтобы запечатать Это. Вкус этой не разбавленной версии настолько хорош, потому что она сбраживается почти в чистом соке. И плотность питательных веществ намного лучше, чем просто использование соленой воды.

Прислушайтесь к размытым звукам, когда он начинает бродить — это очень хороший знак.Мне нравится думать об этом как о моем пении квашеной капусты.

В квашеной капусте, которую я готовлю в банке, обычно достаточно сока без добавления рассола, потому что нет камней, которые можно было бы покрыть. Но я нашинковываю, солю и замешиваю / массирую капусту так же, как и в горшочке. Я оставляю немного свободного пространства над головой, а затем устанавливаю воздушный шлюз, наполняя его водой до нужной отметки. Вуаля, он готов к брожению в красивом прохладном месте в течение 4 дней. Не забудьте поставить его на тарелку, так как иногда сок будет переливаться через воздушный шлюз, когда кислород выходит из банки.Это нормально.

Вы можете проявить творческий подход к квашеной капусте, добавив пурпурную капусту, чтобы придать ей красивый розовый цвет. Вы также можете добавить такие специи, как семена укропа, семена горчицы, кориандр, тимьян, лавровый лист, майоран, чеснок, лук, хрен и другие. Мне нравится делать это каждый раз немного по-другому, для разнообразия. Так никто не устанет есть это.

Вам также могут понравиться: «5 рецептов дегидратора для домашних фруктов и овощей»

Польза для здоровья квашеной капусты домашнего приготовления

Что касается здоровья квашеной капусты, то это один из лучших источников пробиотиков, которые вы можете получить.Живой и процветающий, он принесет пользу вашему организму, не говоря уже об экономии за счет отсутствия необходимости покупать сомнительные пробиотики, которые могут быть дорогостоящими и не всегда жизнеспособными.

«Квашеная капуста, наверное, одна из самых здоровых продуктов», — пишет викарий Себастьян Кнайп. Капитан Джеймс Кук представил квашеную капусту для здоровья всей команды корабля. Благодаря высокому содержанию витамина С, этот ферментированный овощ защитил многих моряков от цинги, «морской чумы».

Последние научные исследования подтверждают многовековой опыт натуральной и популярной медицины: клетчатка поддерживает здоровое пищеварение и снижает уровень холестерина.Молочнокислые бактерии важны для накопления и поддержания здоровой кишечной флоры. Противоязвенный фактор защищает пищеварительную систему от язв желудка и кишечника. Так что приготовлением квашеной капусты я буду заниматься всю оставшуюся жизнь. Понимаете, это беспроигрышный вариант. У него божественный вкус, и он мне тоже полезен!

Что вы думаете?

Каковы ваши лучшие советы и рекомендации по приготовлению вкусной домашней квашеной капусты? Позвольте мне знать в комментариях ниже!

________________________

Это обновленная версия статьи, изначально опубликованной 24 июня 2015 г.В настоящее время автор может быть недоступен для ответа на комментарии, однако мы призываем членов нашего сообщества присоединиться к нам, чтобы поделиться своим опытом и ответить на вопросы!

Grow Network является участником партнерской программы Amazon Services LLC Associates Program, разработанной для того, чтобы наша команда могла зарабатывать деньги за рекомендацию наших любимых продуктов! Мы можем получить небольшую комиссию без каких-либо дополнительных затрат для вас, если вы купите товар после нажатия одной из наших ссылок.Спасибо за поддержку TGN!

(Посетили 8 597 раз, сегодня 1 раз)

Grow Network — это глобальная сеть людей, которые сами производят еду и лекарства. Мы самые крутые исследователи заднего двора на Земле! Мы постоянно делимся, открываем и работаем вместе, чтобы опробовать новые пути к устойчивому образу жизни, при этом восстанавливая связь со «старыми путями», которые ускользают в нашем современном мире. Мы ценим почву, воду, солнечный свет, простоту, устойчивость, полезность и свободу.Мы стремимся производить, готовить и сохранять собственные продукты питания и лекарства, и мы надеемся, что вы тоже!

Что сочетается с квашеной капустой? — Theburningofrome.com

Что сочетается с квашеной капустой?

Добавление салата из тунца, яйца, курицы или картофеля Просто добавьте квашеную капусту или замените маринованные или соленые огурцы в своем любимом рецепте салата из тунца, яйца, курицы или картофеля.

Как долго можно квашивать капусту?

от 3 до 10 дней
Заквашивайте капусту от 3 до 10 дней.Начните пробовать ее через 3 дня — когда квашеная капуста вам понравится, снимите вес, закрутите крышку и поставьте в холодильник. Вы также можете позволить квашеной капусте продолжать брожение в течение 10 дней или даже дольше.

Можно ли слишком долго ферментировать капусту?

Можно ли слишком долго сбраживать квашеную капусту? Да, есть такое понятие, как слишком долгое брожение. Явным признаком того, что вы слишком долго не кладете капусту, является то, что она может стать мягкой. Однако это не единственный фактор, о котором следует знать наверняка.

Что происходит при заквашивании капусты?

Бактерии, в основном виды Leuconostoc, производят углекислый газ (заменяющий последние остатки кислорода в сосуде) и молочную кислоту, которая является естественным побочным продуктом анаэробного дыхания. Лактобациллы дополнительно сбраживают любые оставшиеся в капусте сахара, используя анаэробное дыхание.

Как называется квашенная капуста?

Квашеная капуста
Квашеная капуста, или квашеная капуста, богата витаминами С и К, железом и клетчаткой, а также, естественно, содержит полезные кишечные бактерии, называемые пробиотиками.

Как сбраживается капуста?

Капусту мелко нарезать, посолить и оставить для брожения. Ферментация лактобацилл происходит естественным путем, поскольку эти переносимые воздухом бактерии культивируются на сырых листьях капусты, где они растут. Также присутствуют дрожжи, которые могут давать мягкую квашеную капусту с плохим вкусом при слишком высокой температуре брожения.

Должна ли ферментация быть герметичной?

Должна ли ферментация быть герметичной? Нет! Фактически, первичная ферментация никогда не должна быть герметичной, потому что вы рискуете сорвать верхнюю часть ферментера или полностью его сломать.Поскольку в процессе ферментации образуется углекислый газ, со временем может нарастать невероятное давление.

Можно ли заразиться ботулизмом от ферментированных продуктов?

Пищевой ботулизм, вызванный потреблением неправильно обработанной пищи, является редким, но потенциально смертельным заболеванием, если не диагностировать быстро и не лечить антитоксином. Домашние консервы, консервы или ферментированные пищевые продукты являются частым источником пищевого ботулизма, и их приготовление требует особой осторожности.

Квашеная капуста полезна?

Квашеная капуста, или квашеная капуста, богата витаминами C и K, железом и клетчаткой и, естественно, содержит полезные кишечные бактерии, называемые пробиотиками.Употребляя в пищу такие продукты, как квашеная капуста, мы улучшаем здоровье нашей пищеварительной системы за счет оптимизации кишечной флоры и баланса кишечного микробиома.

Что вызывает брожение капусты?

Как лучше всего приготовить курицу с капустой?

НАПРАВЛЕНИЯ Нагрейте масло в большой кастрюле на среднем огне. Добавьте чеснок и курицу, обжарьте, пока курица не перестанет быть розовой. Добавить лук и грибы, обжарить до полупрозрачности. Добавить капусту, обжарить, пока капуста не станет мягкой, около 5 минут.Добавьте куриный бульон и убавьте огонь до среднего.

Сколько времени нужно для ферментации квашеной капусты?

Домашняя квашеная капуста проста в приготовлении, она полезна для здоровья, имеет вкусный вкус с острой и хрустящей текстурой. Все, что вам нужно, это немного соли и капусты, а также большая банка, необходимая для брожения. Квашеная капуста готовится примерно через 3 дня, но вы можете продолжать ферментацию еще много дней …

Как приготовить щи на курином бульоне?

Добавить чеснок и курицу, обжаривать до тех пор, пока курица не перестанет быть розовой.Добавить лук и грибы, обжарить до полупрозрачности. Добавить капусту, обжарить, пока капуста не станет мягкой, около 5 минут. Добавьте куриный бульон и убавьте огонь до среднего. Накрыть крышкой и варить около 7 минут, пока капуста не станет мягкой.

Как лучше всего ферментировать овощи?

Для приготовления ферментированных овощей: начните со свежих овощей, если возможно, органических. Одни из самых вкусных для ферментации — это капуста, морковь, огурцы, перец, свекла, чеснок и цветная капуста.В миске или стеклянной мерной чашке смешайте 4 стакана фильтрованной воды и 2 столовые ложки не йодированной соли.

Как долго сохраняется квашеная капуста? Это когда-нибудь плохо?

Вот все, что вам нужно знать о хранении, сроке годности и о том, что квашеная капуста портится. Из этой статьи вы узнаете, как определить, плохой ли ваш, и как долго он продержится.

В Интернете много противоречивой информации о квашеной капусте.Некоторые утверждают, что он хранится вечно, в то время как некоторые производители рекомендуют хранить их только неделю после открытия.

Запутаться легко. Эта статья — моя попытка исправить положение.

Для начала давайте поговорим о двух доступных типах квашеной капусты. Знание различий между ними значительно упростит все остальное.

Непастеризованная и пастеризованная квашеная капуста

На рынке доступны два вида квашеной капусты: непастеризованная и пастеризованная.

Основное различие между ними в том, что первый — сырой и живой, с большим количеством пробиотиков, а второй — приготовленный, и большинство пробиотиков мертвы.

И поскольку первый жив и идет процесс брожения, его нужно охладить, чтобы он не слишком сильно бродил и не становился слишком кислым.

В пастеризованной квашеной капусте процесс брожения был остановлен нагреванием, и поэтому живые бактерии отсутствуют.Это означает, что пока банка не открывается, охлаждение не требуется.

Вот почему вы видите квашеную капусту в холодильном отделении, а остальное стоит на полках.

(Некоторые продукты находятся посередине. Они не пастеризованы полностью, но не требуют охлаждения. К счастью, большинство краутов либо одно, либо другое.) Совет

. Если вы покупаете квашеную капусту из-за ее пользы для здоровья, выбирайте ту, которая продается в охлажденном виде.

Зная, что есть два типа квашеной капусты: непастеризованная (продается охлажденной) и пастеризованная (стабильная при хранении), давайте займемся ее порчей, сроком годности и хранением.

Контейнер Sauekraut

Квашеная капуста портится?

Пастеризованная квашеная капуста хранится около недели после открытия и быстро портится. С другой стороны, непастеризованная квашеная капуста может храниться в течение нескольких месяцев после открытия, если вы охладите ее и держите в рассоле. Однако качество его будет постепенно ухудшаться.

Другими словами, пастеризованная квашеная капуста может быстро испортиться, а непастеризованная капуста — нет, при условии, что вы правильно храните капусту.

Конечно, если вы не храните непастеризованную квашеную капусту должным образом, она может довольно быстро высохнуть или даже нарастить плесень. Вот почему так важно о нем хорошо заботиться.

(подробнее о хранении я расскажу позже в статье).

А теперь, прежде чем говорить о признаках порчи, давайте рассмотрим пару вещей, которые поначалу могут показаться странными, но совершенно нормальными для непастеризованной квашеной капусты.

Примечание

Иногда вместо слова «пастеризованный» используется словосочетание «горячая упаковка».По сути, это одно и то же.

Квашеная капуста в рассоле

Что делает непастеризованная квашеная капуста

Как вы уже знаете, в непастеризованной квашеной капусте содержатся живые организмы. Это имеет несколько последствий.

Шипучка и пузыри

Если охлажденная квашеная капуста после открытия становится шипучей и пузырящейся, это нормально. Продолжающаяся ферментация вызывает накопление газа CO2, которому некуда деваться из-за крышки. Теперь, когда вы сняли крышку, скопившийся CO2 может высвободиться, вызывая пузыри.

Вот почему некоторые бренды устанавливают на свои упаковки выпускные клапаны.

(Если вам интересно, то же самое происходит с шампанским.)

Выпуклая крышка

То же, что и выше, скопление газа может иногда приводить к вздутию крышки, и это нормально. Это не обычное явление, но не паникуйте, если это произойдет с вами.

Сложность отвинчивания крышки

Последний эффект накопления СО2 в непастеризованной квашеной капусте заключается в том, что, если она трясется, крышка может быть трудно снять.

Вот две вещи, которые вы можете попробовать, наконец, открыть эту банку:

  • Оставьте емкость при комнатной температуре на 5 минут. Это может помочь немного снизить давление и позволить вам войти.
  • Погрузите край крышки в теплую воду на несколько секунд. Как и выше, мы применяем изменение температуры, чтобы помочь сбросить давление.

Вкус различается между партиями

Так как охлажденная квашеная капуста — это живое существо, каждая партия немного отличается.Так что не беспокойтесь, если вкус этого контейнера немного отличается от предыдущего. К сожалению, это невозможно контролировать.

Теперь, когда вы знаете, что такое охлажденный краут, давайте поговорим о признаках хранения.

Предупреждение

Если ваша ферментированная капуста пастеризована и имеет один из этих признаков, это почти наверняка плохо. Вы можете проверить раздел часто задаваемых вопросов на веб-сайте бренда для подтверждения.

Как определить, вредна ли квашеная капуста?

Салат из квашеной капусты, моркови и яблок

Признаки испорченной квашеной капусты включают:

  • Не имеет запаха. Если странно пахнет, отвратительно или как будто она гниет, очевидно, что квашеная капуста испортилась. Квашеная капуста должна иметь кисловатый и свежий запах.
  • Изменения на поверхности. Если рассол не покроет листья, может произойти несколько вещей. Они могут немного подсохнуть, и это не проблема. Но если их открывать более пары дней, то обнаруживается либо белая пленка (фото ниже), либо плесень. Если у вас непастеризованный краут, теоретически вы можете есть все, что находится под рассолом, но я думаю, что в этом случае лучше отказаться от квашеной капусты.Береженого Бог бережет.
  • Слишком долгое время хранения. Если ваш краут пастеризован и открыт более, скажем, двух недель, пора его убирать. Он не портится быстро, потому что обычно в него добавляют уксус (который помогает предотвратить размножение бактерий), но и длится недолго. Что касается сырой квашеной капусты, выбирайте то, что вам удобно по времени (подробнее об этом позже).

Наконец, если кажется, что все в порядке, дегустация квашеной капусты — последний этап процесса.

Так вот, если это непастеризованный сорт, то он еще жив и брожение продолжается. Это означает, что вкус со временем может измениться, и капуста может потерять часть хрустящей корочки, если она будет храниться в холодильнике в течение нескольких месяцев. Будьте готовы к этому.

В противном случае действуйте интуитивно. Если вкус по-прежнему приятный и время хранения приемлемое, дерзайте.

Белая пленка на квашеной капусте

Как долго сохраняется квашеная капуста?

Кладовая Холодильник
Квашеная капуста (непастеризованная, неоткрытая) Продам + 3+ мес. + месяцев
Квашеная капуста (пастеризованная, неоткрытая) Срок хранения + 3-6 месяцев
Квашеная капуста (пастеризованная, открытая) 5-7 дней Вышеуказанные периоды являются приблизительными и предназначены только для лучшего качества.

Непастеризованная квашеная капуста может храниться от 4 до 6 месяцев после открытия емкости или даже дольше. Качество будет постепенно ухудшаться, но пока капуста покрыта рассолом, ее можно будет безопасно есть.

Пастеризованная квашеная капуста, напротив, обычно хранится от 7 до 10 дней после открытия.

Как вы понимаете, разница между ними огромна в пользу непастеризованного.

Конечно, предполагаемое время хранения зависит от марки .Часто бренды рекомендуют использовать дату окончания срока годности, указанную на этикетке, или, возможно, добавить пару дополнительных месяцев после нее, независимо от того, когда вы открываете контейнер.

Это потому, что процесс брожения продолжается, и хотя капуста будет оставаться безопасной в течение некоторого времени, она будет сохранять пиковый вкус лишь на определенное время. Как кимчи или непастеризованные соленые огурцы (портятся ли соленые огурцы?), Его вкус со временем станет более глубоким, и в какой-то момент он может стать слишком кислым на ваш вкус.

Финики квашеной капусты на этикетке

Что касается пастеризованной квашеной капусты, она хранится в течение нескольких месяцев после истечения срока годности, пока она не открывается. Но как только вы откроете контейнер, у вас будет только неделя и переодеться, чтобы получить наилучшие результаты.

Как я уже упоминал, пастеризованная квашеная капуста обычно содержит уксус в рассоле. Уксус помогает ферментированной капусте храниться дольше, чем обычные 4-5 дней открытия консервов, но время хранения все еще довольно ограничено.

Совет

Прочтите этикетку. Если ваша квашеная капуста пастеризована и на этикетке указано, что вы можете безопасно хранить ее дольше указанного периода, следуйте этой рекомендации.То же самое, если в нем написано, что вы должны его использовать или выбросить в течение 4–5 дней.

Теперь, когда вы знаете, сколько времени нужно после открытия, пора поговорить о том, как хранить квашеную капусту.

Нужно ли охлаждать квашеную капусту?

Непастеризованная (сырая) квашеная капуста требует постоянного охлаждения, а пастеризованная квашеная капуста — только после открытия емкости или банки. Конечно, можно также хранить нераспечатанную пастеризованную квашеную капусту в холодильнике.

Как я уже упоминал, сырая (непастеризованная) квашеная капуста все еще ферментируется, и чтобы замедлить этот процесс, ее необходимо охладить.

Если оставить на прилавке, то процесс ускорится. И хотя от этого капуста не обязательно испортится, ее вкус станет намного острее за считанные дни.

(Что, по сути, делает квашенную капусту бесполезной или плохой).

Пастеризованная квашеная капуста не ферментируется, поэтому охлаждение не требуется.Вместо этого вы можете относиться к нему так же, как и ко всем остальным овощным консервам. Это означает, что вы перекладываете его в холодильник только после того, как откроете банку или банку.

Разобравшись с этим, давайте поговорим о важнейшей практике хранения — хранении капусты в рассоле.

Салат Sauekraut крупным планом

Засыпать капусту в рассол

После того, как вы откроете квашеную капусту, убедитесь, что все в порядке и погружено в рассол, прежде чем возвращать остатки в холодильник.И каждый раз, когда вы зачерпываете немного капусты, не забудьте надавить на оставшуюся часть капусты, чтобы она оставалась закрытой.

В противном случае капуста, находящаяся в воздухе, начнет сохнуть, и в течение нескольких дней на поверхности появятся белые пятна (и, в конечном итоге, белая пленка) или плесень. Об этом я уже говорил в разделе о браке.

А что, если в емкости слишком мало рассола, чтобы красиво покрыть всю капусту?

К счастью, есть простое решение этой проблемы — вы можете приготовить дополнительный рассол.Вот как.

Квашеная капуста крупным планом

Приготовление экстра рассола

Сделать собственный рассол очень просто. Все, что вам нужно, это вода и соль.

Мы собираемся приготовить 2% -ный (приблизительно) рассол, что довольно стандартно для приготовления квашеной капусты. Если вам нравится более соленый вкус, вы можете добавить больше соли.

Чтобы приготовить рассол, растворите 1 чайную ложку соли в 1 стакане воды. Если вам нужно больше рассола, увеличьте количество ингредиентов вдвое или втрое.

Когда раствор будет готов, вылейте в емкость с квашеной капустой столько, сколько нужно, чтобы покрыть капусту.Вот и все.

Вот как это выглядит:

Как только капуста накрывается и накрывается, вы можете вернуть ее в холодильник, где она будет храниться в течение нескольких месяцев.

Сколько времени нужно, чтобы заквашить квашеную капусту в кувшине?

Затем закройте кастрюлю крышкой. Дайте бродить при комнатной температуре (около 72 градусов по Фаренгейту) от 5 до 10 дней . В течение первых 24 часов несколько раз загляните внутрь кувшина, чтобы убедиться, что капуста выделила достаточно сока, чтобы подняться над листьями капусты примерно на дюйм (чтобы квашеная капуста была полностью погружена в воду).

Как долго должна бродить квашеная капуста?

Температура, время и управление брожением

Храните контейнер при температуре от 70 до 75 ° F во время ферментации. При этих температурах квашеная капуста будет полностью ферментирована примерно за от трех до четырех недель , при температуре от 60 до 65 ° F, ферментация может занять шесть недель. При температуре ниже 60 ° F квашеная капуста не ферментируется.

Как узнать, что квашеная капуста закончила брожение?

На отметке 7 дней (5 дней, если брожение в теплой среде, 10 дней, если у вас очень прохладно), откройте банку, вытащите небольшую банку или груз, понюхайте и попробуйте квашеную капусту.Он должен начинаться с на кислый вкус и больше не иметь привкус соленой капусты. Его цвета должны быть блеклыми и не яркими, как у свежей капусты.

Сколько времени нужно, чтобы квашеная капуста была готова?

Ваша квашеная капуста должна быть готова примерно через 4-6 недель . Вы узнаете наверняка, как только пузырьки в жидкости перестанут появляться. Чем дольше вы даете капусте бродить, тем более острым будет ее вкус.

Как ускорить брожение квашеной капусты?

Как быстрее ферментировать пищу

  1. Используйте меньше соли.…
  2. Добавьте другие бактерии (например, рассол из другого активного фермента или сыворотку).
  3. Храните фермент в теплом месте (будьте осторожны, чтобы не быть слишком теплым, температура до 70 градусов может замедлить и в конечном итоге предотвратить брожение).
  4. Очистите твердые овощи (например, морковь или соленые огурцы).

Как работает кувшин для брожения?

После того, как запечатанная вода упакована, в чашу помещаются два полукруглых груза, чтобы фермент оставался погруженным.Затем крышка помещается в открытый ров, который затем заполняется водой. Теперь посторонний воздух не может попасть в кувшин, а углекислый газ, образующийся во время брожения, легко пузырится.

Как долго должен бродить острый соус?

Во-первых, лучше всего выращивать острый соус при комнатной температуре, пока цвет перца не изменится и не станет тусклым. Это займет около от 5 до 7 дней . Ферментация наиболее активна в течение первых 1-2 недель, но вы можете ферментировать еще дольше, чтобы острый соус приобрел больше аромата.

Сколько времени нужно, чтобы капуста заквашилась в квашеную капусту?

Накройте ванну и оставьте в темном месте при прохладной комнатной температуре (около 18-20 ° C) не менее пяти дней. Он будет готов к употреблению через пять дней, но для максимального аромата оставьте капусту для брожения в любом месте между 2-6 неделями (или до тех пор, пока пузыри не утихнут).

Как узнать, работает ли ферментация?

Единственный способ убедиться, что брожение завершилось, — это измерить удельный вес .Через десять дней после внесения дрожжей вы должны взять образец пива из ферментера и измерить плотность. Затем вы делаете еще одно измерение через два дня, если оба значения одинаковы, ферментация прекратилась.

Можно ли заразиться ботулизмом от квашеной капусты?

Могут ли маринованные соленья или квашеная капуста вызвать ботулизм? No. Ферментация продуктов создает среду, которая не нравится ботулизму .

Почему моя квашеная капуста не ферментируется?

Слишком жарко или слишком холодно ? Конечно, можно оставить квашеную капусту дозреть до смерти при действительно высокой температуре и не замечать этого, если вы не пробуете ее регулярно.Даже за день или два он может превратиться из хрустящего и кислого в слизистый и зловонный. Слишком низкая температура замедлит процесс брожения.

Стоит ли перемешивать квашеную капусту?

В соответствии с передовой практикой, не перемешивайте и не утяжеляйте квашеную капусту .

Становится ли квашеная капуста более кислой, чем дольше она бродит?

Вкус маринованных овощей и квашеной капусты со временем станет более сложным . Текстуры тоже могут меняться.Если вам нравится более хрустящая квашеная капуста, сбраживайте ее меньше времени, если вам нравится более мягкая капуста, дайте ей дольше.

Можете ли вы ускорить процесс брожения?

Скорость брожения можно увеличить несколькими способами. И лаг-фазу, и активную фазу брожения можно сократить, увеличив скорость внесения дрожжей. Начальная температура брожения может быть повышена до , как и температура активного брожения.

Ускоряет ли тепло брожение?

Температура играет решающую роль в брожении.Чтобы дрожжи были здоровыми, они должны быть достаточно теплыми, но слишком горячие вызовут стресс у дрожжей. Слишком круто, и дрожжи будут вялыми и сонными. При повышении температуры скорость брожения увеличивается. .

Помогает ли соль брожению?

Соль — важный ингредиент в ферментации . Он не только препятствует размножению нежелательных бактерий, но также помогает сохранять овощи хрустящими и хрустящими, добавляет аромат, сохраняет содержание витаминов и может замедлить процесс ферментации, чтобы аромат раскрылся более полно.

Анализ микробного сообщества квашеной капусты показывает стабильное и быстро установившееся сообщество

Foods. 2018 Май; 7 (5): 77.

Оба автора внесли одинаковый вклад.

Поступило 10.04.2018 г .; Принято 10 мая 2018 г.

Лицензиат MDPI, Базель, Швейцария. Эта статья представляет собой статью в открытом доступе, распространяемую в соответствии с условиями лицензии Creative Commons Attribution (CC BY) (http: // creativecommons.org / licenses / by / 4.0 /). Эту статью цитировали в других статьях в PMC.

Abstract

Несмотря на недавний интерес к микробным сообществам ферментированных продуктов, было мало исследований динамики бактериального сообщества квашеной капусты, одного из старейших и наиболее распространенных в мире ферментированных продуктов. В этом исследовании мы используем секвенирование ампликона 16S рРНК для профилирования микробного сообщества естественно ферментированной квашеной капусты на протяжении всего процесса ферментации, а также анализируем бактериальные сообщества исходных ингредиентов и производственной среды.Наши результаты показывают, что микробиом квашеной капусты быстро устанавливается после начала ферментации и что сообщество остается стабильным благодаря ферментации и упаковке для коммерческой продажи. Наш высокопроизводительный анализ согласуется с предыдущими исследованиями, в которых использовались традиционные микробиологические оценки, но расширяет выявленную таксономию. Кроме того, мы обнаружили, что микробные сообщества исходных ингредиентов и производственная среда демонстрируют низкое относительное содержание молочнокислых бактерий, которые преобладают в ферментированной квашеной капусте.

Ключевые слова: квашеная капуста, микробиом, ферментация, пробиотики, высокопроизводительное секвенирование

1. Введение

Квашеная капуста, ферментированный продукт, приготовленный в основном из капусты, является одним из самых известных видов ферментированных продуктов питания, начиная с прошлого века в Римскую империю. Исторически она служила источником питательных веществ в зимние месяцы, когда свежих продуктов было мало, поскольку правильная ферментация сохраняет питательную ценность капусты, создавая желаемые сенсорные свойства [1,2].Он чаще всего ассоциируется с культурами Центральной и Восточной Европы, хотя его можно найти и в западноевропейской кухне. Считается, что квашеная капуста является частью американского рациона с момента основания страны, обычно в качестве ингредиента для приготовления пищи, гарнира или приправы. Его популярность снизилась с 1930-х годов в результате изменения потребительских предпочтений и отсутствия единообразия продукта [1,3]; Однако достижения в области науки о ферментации пищевых продуктов и современные интересы потребителей сделали квашеную капусту новой популярностью в последние годы.Сегодня в Соединенных Штатах широко продаются как массовые, так и кустарные приготовления квашеной капусты.

Производство и характеристики квашеной капусты в значительной степени зависят от местного микробного сообщества и условий ферментации [4]. Хотя микробный состав квашеной капусты может варьироваться на начальных этапах ферментации, соответствующие условия ферментации, такие как температура и относительная концентрация ингредиентов, гарантируют, что молочнокислые бактерии (LAB) являются доминирующими микроорганизмами в конечном ферментированном продукте.Эти LAB имеют решающее значение для успешной ферментации; они производят органические кислоты, бактериоцины, витамины и ароматизирующие соединения, ответственные за многие характерные сенсорные качества ферментированных пищевых продуктов, включая увеличенный срок хранения, вкус и питательную ценность [5,6,7,8]. Кроме того, предполагается, что некоторые LAB действуют как пробиотики, которые способствуют здоровью человека и стабильности микробиома [9,10]. Хотя эти утверждения еще не были полностью подтверждены учеными, эта точка зрения способствовала недавнему росту потребительской популярности и потребления в Соединенных Штатах [11].

Каноническая ферментация квашеной капусты начинается с первоначального распространения Leuconostoc mesenteroides , который быстро производит углекислый газ и кислоту. Это быстро снижает pH окружающей среды, подавляя рост нежелательных микроорганизмов, которые могут вызвать порчу пищевых продуктов, сохраняя при этом цвет капусты [12]. Действие L. mesenteroides изменяет среду ферментации, так что это способствует преемственности других LAB, таких как Lactobacillus brevis и Lactobacillus plantarum [12].При традиционном производстве квашеной капусты этот процесс продолжается при 18 ° C в течение примерно одного месяца [12]. Комбинация метаболитов, производимых этими организмами, приводит к появлению в конечном продукте благоприятных сенсорных качеств — уникальных вкусов, ароматов и текстур, связанных с ферментированными продуктами [12,13]. Температура ферментации также играет важную роль с точки зрения цвета, вкуса и сохранности [12].

Исторически важным видом ферментации квашеной капусты считались L.mesenteroides, L. plantarum и L. brevis , что подтверждается недавними исследованиями [12,14]. Считается, что в случае аномально высокой температуры или солености, Enterococcus faecalis и Pediococcus cerevisiae играют роль в процессе ферментации [12]. Однако эти наблюдения были основаны на исследованиях, в которых для выделения бактерий использовались методы культивирования, которые по своей природе предвзяты из-за их неспособности улавливать ряд некультивируемых бактерий. Недавние исследования также определили, что род Weissella важен для ранних ферментативных процессов [14].

Последние достижения в технологии высокопроизводительного секвенирования создали потенциал для высокоточной, независимой от культуры характеристики микробиома квашеной капусты. Появление технологии секвенирования ампликона 16S рРНК сделало возможным систематический анализ микробиома квашеной капусты до, во время и после ферментации. Квашеная капуста, сброженная при более высоких температурах, исторически считается более низкого качества, чем квашеная капуста, сброженная при низких температурах; однако современные методы промышленного производства обращаются к ферментации при теплой температуре, поскольку она резко сокращает время производства.

Здесь мы анализируем таксономический состав квашеной капусты, сброженной при комнатной температуре, в течение 14-дневного периода ферментации. В целом таксономический состав этой квашеной капусты соответствует таксономическому составу, наблюдаемому в квашеной капусте, сброженной в традиционном диапазоне низких температур, что позволяет предположить, что ферментация при теплой температуре может быть жизнеспособным вариантом для производства квашеной капусты с соответствующей структурой бактериального сообщества. с квашеной капустой, полученной более традиционным холодным брожением.Это может представлять особый интерес для промышленных и коммерческих производителей, которые смогут ускорить свой производственный процесс без ущерба для таксономического состава, который лежит в основе интереса потребителей к пробиотикам и ферментированным продуктам питания.

2. Материалы и методы

2.1. Приготовление квашеной капусты и методы отбора проб

Квашеная капуста для этого исследования была взята из одной партии весом 50 фунтов, подготовленной для коммерческой продажи в июне 2017 года на предприятии, расположенном недалеко от Провиденса, Род-Айленд.Перед добавлением тмина (<1% по весу) капусту засалили до концентрации 2,25%. Образцы ингредиентов были собраны в трех экземплярах в течение обычного производственного цикла; 0,5 г каждого ингредиента помещали в пробирки Эппендорфа объемом 1,5 мл, содержащие 500 мкл воды, свободной от нуклеаз. Партию квашеной капусты запечатали в герметичные пластиковые бочки на время брожения. Ферментация проводилась примерно при 21 ° C. Успешная ферментация определялась конечным pH ниже 3,6. Образцы ферментации собирали в трех экземплярах с помощью пипеток Пастера из сброженной квашеной капусты в дни 0, 2, 7, 10 и 14.Образцы не являются настоящими биологическими копиями, поскольку все тройные копии были получены из одной и той же партии сброженной квашеной капусты; это ограничение нашего исследования, и будущие исследования должны изучить согласованность динамики микробиома между партиями. Упакованная квашеная капуста в банках от этого производителя была куплена у коммерческого дистрибьютора и обработана вместе с образцами ферментации для анализа микробиома готового продукта.

Для отбора проб производственной среды производственный стол, промышленная раковина и пол производственного помещения были трижды промыты флокированными стерильными тампонами; затем их хранили по отдельности в пробирках для лизиса ДНК / РНК Zymo Research (Zymo Research, Ирвин, Калифорния, США; кат.: R1103).Для отбора проб воздуха в помещении пустые чашки Петри оставляли открытыми по всему помещению на протяжении всего периода ферментации. На 14-й день с чашек Петри брали мазки, как описано выше. После сбора все образцы были немедленно доставлены в лабораторию на льду и хранили при -80 ° C до обработки.

2.2. Экстракция ДНК, подготовка библиотеки 16S и секвенирование

Образцы квашеной капусты, окружающей среды и ингредиентов были обработаны с использованием набора ZymoBIOMICS DNA Microprep Kit (Zymo Research, Irvine, CA, USA; Cat: D4305) в соответствии с инструкциями производителя для экстракции ДНК.Используя протокол Earth Microbiome Project 16S Illumina Amplicon, мы нацелены на гипервариабельную область V4 бактериального гена 16S рРНК, используя обратный праймер 806Rb (GGACTACCAGGGTATCTAATCC) и прямой праймер 515F со штрих-кодом (CAGCAGCCGCGGTAAT) [15,16,17,18,18] . ПЦР-ампликоны генерировали с использованием полимеразы Phusion High-Fidelity (New England BioLabs, Ипсвич, Массачусетс, США) в следующих условиях: 98 ° C в течение 3 минут, затем 35 циклов при 98 ° C в течение 45 с, 50 ​​° C в течение 60 секунд. с, и 72 ° C в течение 90 с, и заканчивая конечным удлинением при 72 ° C в течение 10 минут.

Концентрации ампликона

для ПЦР анализировали с использованием флуориметра Qubit 3.0 и набора dsDNA-HS (Thermo Fisher Scientific, Waltham, MA, USA) в соответствии с инструкциями производителя. Равные количества ампликонов из каждого образца объединяли, концентрировали и очищали в геле с использованием набора Machery-Nagel NucleoSpin и PCR Clean-Up (Machery-Nagel, Düren, Германия, Cat: 740609) в соответствии с инструкциями производителя. Объединенные образцы были отправлены в Центр геномики и секвенирования Род-Айленда при Университете Род-Айленда (Кингстон, Род-Айленд, США) для контроля качества и секвенирования.Ампликоны секвенировали по парным концам (2 × 250 п.н.) на платформе Illumina MiSeq с использованием набора на 500 циклов со стандартными протоколами.

2.3. Анализ разреженности и секвенирования

Необработанные показания FASTQ с парных концов были демультиплексированы с помощью idemp (https://github.com/yhwu/idemp/blob/master/idemp.cp) и импортированы в программу Quantitative Insights Into Microbial Ecology 2 ( QIIME2, версия 2017.9.0, https://qiime2.org/). Необработанные считывания были впоследствии депонированы в базу данных архива считывания последовательностей (SRA) Национального центра биотехнологической информации (NCBI) под регистрационным номером SRA SRP145097.Алгоритм устранения шумов 2 Divisive Amplicon (DADA2) использовался для качественной фильтрации, обрезки, устранения шума и объединения данных. Химерные последовательности удаляли методом консенсуса. Классификатор объектов в QIIME2, обученный с помощью базы данных 99% операционных таксономических единиц (OTU) SILVA и обрезанный до области V4 16S, был использован для присвоения таксономии всем вариантам рибосомной последовательности. Загрязняющие последовательности митохондрий и хлоропластов были отфильтрованы из полученной таблицы характеристик. Остальные репрезентативные последовательности были выровнены с помощью MAFFT и использованы для филогенетической реконструкции в FastTree.Наконец, показатели разнообразия были рассчитаны с помощью плагина разнообразия QIIME2 и визуализированы с помощью Prism (версия 7.0a, GraphPad, Ла-Хойя, Калифорния, США).

После качественной фильтрации и предварительной обработки мы определили, что 8 из наших 37 секвенированных образцов имели менее 650 считываний, что мы сочли недостаточным для статистически мощного анализа разнообразия и, следовательно, потенциальным источником систематической ошибки. Поэтому мы удалили эти образцы с плохим чтением из последующего анализа альфа- и бета-разнообразия. Пять выброшенных образцов были распределены по разным ингредиентам и типам образцов окружающей среды.Учитывая низкую вариацию между двумя оставшимися повторами в этих типах образцов, мы считаем, что двух повторов достаточно для публикации. Три других образца с плохим считыванием были троекратными образцами ферментации, начиная с дня 0. В этих образцах преобладали контаминирующие считывания хлоропластов, которые были удалены с помощью вычислений. Остальные бактериальные считывания были достаточно низкими, что представляло проблему для измерений альфа- и бета-разнообразия. Низкое количество считываний бактерий в образцах дня 0 и других наших образцах, вероятно, является отражением изначально низкой численности бактерий в этих сообществах.Хотя это ограничивает потенциальные возможности наших выводов, это неизбежный результат работы с сообществами с низкой численностью. Это отражается в отсутствии Дня 0 в и. Чтобы визуализировать бактериальное сообщество в момент времени 0 дня, мы использовали менее строгий предел для включения образца в гистограммы наших таксонов — 250 показаний (). Это позволило нам повторно захватить все три повтора из дня 0 и получить представление о структуре этих сообществ в отсутствие анализа разнообразия.

Показатели альфа-разнообразия образцов квашеной капусты, ингредиентов и окружающей среды.( A ) индекс Шеннона; и ( B ) Филогенетическое разнообразие Фэйтс. Планки погрешностей представляют собой стандартную ошибку среднего.

PCoA, отображающее невзвешенное расстояние UniFrac между образцами квашеной капусты, окружающей средой и микробиомом ингредиентов.

Относительная численность бактериальных таксонов в пробах квашеной капусты, ингредиентах и ​​окружающей среде на уровне порядка ( A ) и рода ( B ). Показаны только семь верхних таксонов из групп образцов ферментации и ингредиентов / окружающей среды.

3. Результаты

Значения альфа-разнообразия окружающей среды, ингредиентов и ферментирующей квашеной капусты были измерены как с помощью индекса разнообразия Шеннона, так и филогенетического разнообразия Фэйт. Эти значения показывают снижение бактериального разнообразия для ферментации квашеной капусты по сравнению с исходными ингредиентами и окружающей средой (). Однако мы наблюдаем контрастирующие паттерны альфа-разнообразия между показателями разнообразия Шеннона и филогенетического разнообразия Faith в процессе ферментации.Индекс разнообразия Шеннона указывает на последовательное увеличение альфа-разнообразия квашеной капусты с течением времени, в то время как филогенетическое разнообразие Фейт предполагает постоянное низкое альфа-разнообразие. Мы связываем это с тем, что сегменты индекса разнообразия Шеннона тесно связаны и, возможно, перекрывают LAB в отдельные таксоны. Это создает ложную видимость разнообразия. В отличие от этого, индекс филогенетического разнообразия Faith использует длины ветвей в качестве основы для присвоения показателей разнообразия и не разделяет LAB с одинаковым уровнем детализации.Тем не менее, низкий уровень разнообразия продукта ферментации, показанный на обоих графиках, вероятно, является результатом селективного давления в среде ферментации, включая низкий pH, анаэробные условия и высокую соленость. Это свидетельствует об успешном брожении.

Затем мы использовали анализ основных координат (PCoA) с невзвешенным расстоянием UniFrac, чтобы визуализировать различия в структурах сообществ между нашими выборками (). Образцы демонстрировали четкую кластеризацию по типу образца — сырой ингредиент, среда или момент времени ферментации, что указывало на то, что присутствующие бактериальные сообщества значительно отличаются друг от друга.Это ожидается для образцов окружающей среды по сравнению с исходными ингредиентами или точками времени ферментации, но было неожиданным для исходных ингредиентов по сравнению с ферментирующей квашеной капустой. Образец дня 0, полученный из исходной смеси ингредиентов, намного больше похож на сообщество квашеной капусты 14 дня, чем на сырые ингредиенты (). Это говорит о том, что давление отбора, присущее ферментации, оказывает сильное и немедленное воздействие на бактерии, обнаруженные в сырых ингредиентах.

Чтобы дополнительно охарактеризовать бактериальное сообщество, обнаруженное в каждом из собранных образцов, мы исследовали таксономические структуры наших бактериальных сообществ на уровне порядка и рода ().На уровне заказа мы видим различия в бактериальном составе между образцами сырых ингредиентов, образцами окружающей среды и образцами ферментации (A). Категории сырых ингредиентов и экологических объектов довольно похожи друг на друга. Морская соль немного отличается от кочанной капусты и тмина, что может быть связано с тем, что соль не является растительным продуктом и, вероятно, оказывает сильное галофильное давление отбора. В целом эти две категории образцов заметно отличаются от бактериальных сообществ, обнаруженных во время ферментации.Образец дня 0 содержит значительно больше бактериальных таксонов, чем образцы последующих временных точек, и демонстрирует резкое падение количества видов бактерий, присутствующих в течение первых 48 часов ферментации. Наиболее многочисленным отрядом бактерий в образце ферментации в день 0 является Pseudomonadales, который также является одним из самых распространенных видов бактерий во всех образцах окружающей среды. Это говорит о том, что окружающая среда играет определенную роль в создании первоначального бактериального сообщества комбинированных ингредиентов.По прошествии двух дней наиболее многочисленными присутствующими бактериями являются Lactobacillales, что ожидается в случае успешной ферментации. Этот образец сохраняется во время брожения и сотрясения.

На уровне родов мы обнаруживаем, что сохраняются многие из тех же тенденций (B). Три образца ингредиентов выглядят наиболее схожими на этом уровне: Halomonas являются общими и преобладающими во всех трех образцах. Образцы окружающей среды продолжают демонстрировать сходство, а отсутствие сходства между образцами окружающей среды и образцами ферментации дня 0 сохраняется здесь, как и на уровне порядка.LAB доминируют над другими образцами ферментации, как и на уровне порядка, с Leuconostoc и Lactobacillus в качестве доминирующих родов. Это соответствует результатам, опубликованным Pederson и Albury 1969, которые показали, что Leuconostoc и Lactobacillus являются основными участниками процесса ферментации квашеной капусты [12].

4. Обсуждение

В целом, наши результаты показывают, что, несмотря на более теплый и быстрый процесс ферментации, используемый для производства квашеной капусты, анализируемой здесь, бактериальное сообщество соответствует таковому в более традиционных, более холодных продуктах из квашеной капусты.В течение первых 48 часов ферментации микробное сообщество квашеной капусты испытало резкое падение количества присутствующих бактериальных таксонов, вероятно, из-за сильного селективного давления высокой солености и кислотности в среде ферментации. В течение оставшейся части периода ферментации LAB оставались доминирующими организмами, присутствующими в сообществе. Оба образца свидетельствуют об успешном брожении.

Возможно, более удивительными были взаимоотношения между микробными сообществами исходных ингредиентов, средой ферментации и ферментирующей квашеной капустой.Основные LAB, обнаруженные в ферментирующей квашеной капусте, присутствовали только в очень низких количествах в исходных ингредиентах, что может указывать на то, что для инициирования ферментации необходимы только следовые количества LAB. Также возможно, что обилие LAB ферментативной квашеной капусты, обнаруженное вокруг производственного объекта, особенно в воздухе, может способствовать возникновению ферментативного сообщества, выступающего в качестве закваски. Присутствие LAB в окружающей среде также может быть прямым результатом ферментации квашеной капусты в ней.Эти гипотезы требуют дальнейшего изучения.

В предыдущих исследованиях использовались методы, основанные на культивировании и секвенировании, для выяснения сообщества ферментативных микробов квашеной капусты. Методы, основанные на культуре, показали, что основными LAB, участвующими в ферментации квашеной капусты, являются E. faecalis , L. mesenteroides , L. brevis , P. cerevisiae и L. plantarum; , тогда как методы, основанные на секвенировании, выделяют виды Lactobacillus и Leuconostoc в дополнение к Weissella [11,13].Наши результаты с использованием секвенирования 16S рРНК совпали с этими ожиданиями и расширили предыдущие знания, идентифицировав Leuconostoc, Lactobacillus и Enterobacteriaceae в дополнение к множеству ранее не обнаруженных LAB, таких как Lactococcus .

Наши результаты также соответствуют каноническим микробным сообществам других ферментированных овощных продуктов. Xiong et al. обнаружили, что виды Lactobacillus и Leuconostoc были основными бактериями в ферментации квашеной капусты китайской, pàocài [20].Многочисленные исследования показали, что в бактериальном сообществе кимчи преобладают виды Weisella, Lactobacillus, и Leuconostoc, [21,22,23]. Исследование традиционных вьетнамских ферментированных овощей, таких как горчица и свекла ( dua muoi ) и ферментированные баклажаны ( cà muối ), обнаружило преобладание в ферментации видов Lactobacillus [24].

Наши результаты показывают, что более теплое и быстрое производство может дать квашеную капусту с таким же микробным сообществом, что и квашеная капуста, полученная традиционными методами ферментации.Это может означать, что процесс быстрого брожения является жизнеспособным вариантом для промышленного производства квашеной капусты. Это может быть интересно для коммерческих производителей, поскольку это позволит им ускорить и расширить производство без ущерба для целостности сообщества ферментативных бактерий, что является центральным элементом предполагаемых пробиотических преимуществ квашеной капусты и других ферментированных продуктов.

Хотя проанализированные сообщества были примерно аналогичны ранее опубликованным данным по квашеной капусте, мы еще не можем утверждать, что продукты идентичны или что производственные процессы взаимозаменяемы.Есть несколько показателей — физические, сенсорные и питательные, — которые не исследовались в рамках этого исследования и, возможно, могут варьироваться между двумя типами квашеной капусты. Мы ожидаем, что ухудшение внешнего вида, срока хранения, вкуса и питательной ценности более теплой квашеной капусты может отрицательно сказаться на ее коммерческой жизнеспособности. Следовательно, необходимы дополнительные исследования и измерения этих качеств до широкого коммерческого внедрения этого метода ферментации.

Благодарности

Исследовательская деятельность, связанная с этим исследованием, была частично профинансирована Центром компьютерной биологии болезней человека COBRE (NIH P20 GM109035).Секвенирование проводилось в Центре геномики и секвенирования Род-Айленда, исследовательском центре NSF EPSCoR штата Род-Айленд, частично поддерживаемом Соглашением о сотрудничестве NSF ESPCoR № EPS-1004057. M.A.Z была поддержана стипендиатом Карен Т. Ромер по обучению и исследованиям, а также D.J.C. был поддержан стипендией для аспирантов Национального научного фонда (грант № 1644760).

Вклад авторов

M.A.Z. и П. совместно разработали это исследование и собрали все образцы на производственном объекте.D.J.C, J.I.W. и M.A.Z. извлечена и подготовлена ​​ДНК для секвенирования. W.H.S. и D.J.C. выполнены все анализы. M.A.Z., W.H.S., D.J.C., J.I.W. и P.B. подготовил рукопись. Все авторы рассмотрели и одобрили его окончательную версию.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Ссылки

1. Trail A.C., Fleming H.P., Young C.T., McFeeters R.F. Химическая и сенсорная характеристика коммерческой квашеной капусты. J. Food Qual. 1996; 19: 15–30.DOI: 10.1111 / j.1745-4557.1996.tb00402.x. [CrossRef] [Google Scholar] 2. Варзакас Т., Закинтинос Г., Проэстос К., Радванска М. Ферментированные овощи. В: Йылдыз Ф., Вили Р.С., редакторы. Минимально обработанные охлажденные фрукты и овощи. Springer; Бостон, Массачусетс, США: 2017. С. 537–584. [Google Scholar] 3. Флеминг Х.П., Макфитерс Р.Ф., Даешель Р.Ф. Сборник методов микробиологического исследования пищевых продуктов. Американская ассоциация общественного здравоохранения; Вашингтон, округ Колумбия, США: 1992. Ферментированные и подкисленные овощи; стр.929–952. [Google Scholar] 4. Стамер Дж. Р., Стойла Б. О., Дункель Б. А. Скорость роста и закономерности ферментации молочнокислых бактерий, связанных с ферментацией квашеной капусты. J. Milk Food Technol. 1971; 34: 521–525. DOI: 10.4315 / 0022-2747-34.11.521. [CrossRef] [Google Scholar] 5. Cheigh H.S., Park K.Y. Биохимические, микробиологические и пищевые аспекты кимчи (корейские ферментированные овощные продукты) Crit. Rev. Food Sci. Nutr. 1994; 34: 175–203. DOI: 10.1080 / 10408399409527656. [PubMed] [CrossRef] [Google Scholar] 6.Сеттанни Л., Корсетти А. Применение бактериоцинов в биоконсервации растительных пищевых продуктов. Int. J. Food Microbiol. 2008. 121: 123–138. DOI: 10.1016 / j.ijfoodmicro.2007.09.001. [PubMed] [CrossRef] [Google Scholar] 7. Ли Х., Юн Х., Джи Й., Ким Х., Пак Х., Ли Дж., Шин Х., Хольцапфель В. Функциональные свойства штаммов Lactobacillus, выделенных из кимчи. Int. J. Food Microbiol. 2011; 145: 155–161. DOI: 10.1016 / j.ijfoodmicro.2010.12.003. [PubMed] [CrossRef] [Google Scholar] 8. Терпин В., Хамблот К., Гайот Дж.-П. Генетический скрининг функциональных свойств молочнокислых бактерий в суспензии ферментированного проса и в метагеноме ферментированных крахмалистых продуктов. Прил. Environ. Microbiol. 2011; 77: 8722–8734. DOI: 10.1128 / AEM.05988-11. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Юнг А., Вадстрём Т. Молочнокислые бактерии как пробиотики. Curr. Вопросы Intest. Microbiol. 2006; 7: 73–89. [PubMed] [Google Scholar] 10. Джи Ю., Ким Х., Пак Х., Ли Дж., Ли Х., Шин Х., Ким Б., Франц К.М.А.П., Хольцапфель В.H. Функциональность и безопасность штаммов молочнокислых бактерий из корейского кимчи. Пищевой контроль. 2013; 31: 467–473. DOI: 10.1016 / j.foodcont.2012.10.034. [CrossRef] [Google Scholar] 11. Кларк Т.К., Блэк Л.И., Стассман Б.Дж., Барнс П.М., Нахин Р.Л. Тенденции в использовании дополнительных подходов к охране здоровья среди взрослых: США, 2002–2012 гг. Natl. Статистика здоровья. Отчет 2015; 79: 1–16. [Google Scholar] 12. Педерсон К.С., Олбери М.Н. Бюллетень: номер 824: Брожение квашеной капусты. Сельскохозяйственная опытная станция; Нью-Йорк, Нью-Йорк, США: 1969.[Google Scholar] 14. Пленгвидья В., Брейдт Ф., Лу З., Флеминг Х.П. ДНК-фингерпринт молочнокислых бактерий в ферментациях квашеной капусты. Прил. Environ. Microbiol. 2007. 73: 7697–7702. DOI: 10.1128 / AEM.01342-07. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Caporaso J.G., Kuczynski J., Stombaugh J., Bittinger K., Bushman F.D., Costello E.K., Fierer N., Peña A.G., Goodrich J.K., Gordon J., et al. QIIME позволяет анализировать данные секвенирования сообщества с высокой пропускной способностью. Nat. Методы. 2010. 7: 335–336.DOI: 10.1038 / nmeth.f.303. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16. Капорасо Дж. Г., Лаубер С. Л., Уолтерс В. А., Берг-Лайонс Д., Хантли Дж., Фирер Н., Оуэнс С. М., Бетли Дж., Фрейзер Л., Бауэр М. и др. Сверхвысокопроизводительный анализ микробного сообщества на платформах Illumina HiSeq и MiSeq. ISME J. 2012; 6: 1621–1624. DOI: 10.1038 / ismej.2012.8. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 17. Уолтерс В., Хайд Э. Р., Берг-Лайонс Д., Акерманн Г., Хамфри Г., Парада А., Гилберт Дж.A., Jansson J.K., Caporaso J.G., Fuhrman J.A. и др. Улучшенный бактериальный ген 16S рРНК (V4 и V4-5) и праймеры для генов-маркеров внутреннего транскрибированного спейсера грибов для исследований микробного сообщества. mSystems. 2016; 1: e00009-15. DOI: 10.1128 / mSystems.00009-15. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Томпсон Л.Р., Сандерс Дж. Г., Макдональд Д., Амир А., Ладау Дж., Лосей К. Дж., Прилл Р. Дж., Трипати А., Гиббонс С. М., Акерманн Г. и др. Консорциум проекта «Микробиом Земли» Общий каталог раскрывает многомасштабное микробное разнообразие Земли.Природа. 2017; 104: 11436. DOI: 10,1038 / природа24621. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 19. Cabral D.J., Wurster J.I., Flokas M.E., Alevizakos M., Zabat M., Korry B.J., Rowan A.D., Sano W.H., Andreatos N., Ducharme R.B. и др. Микробиом слюны одинаков у разных субъектов и устойчив к воздействиям краткосрочной госпитализации. Sci. Отчет 2017; 7: 11040. DOI: 10.1038 / s41598-017-11427-2. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 20. Сюн Т., Гуань Ц., Сун С., Хао М., Се М. Динамические изменения флоры молочнокислых бактерий при брожении китайской квашеной капусты. Пищевой контроль. 2012; 26: 178–181. DOI: 10.1016 / j.foodcont.2012.01.027. [CrossRef] [Google Scholar] 21. Ли М., Сон Дж. Х., Юнг М. Ю., Ли С. Х., Чанг Дж. Ю. Крупномасштабный целевой метагеномический анализ бактериальных экологических изменений в 88 образцах кимчи в процессе ферментации. Food Microbiol. 2017; 66: 173–183. DOI: 10.1016 / j.fm.2017.05.002. [PubMed] [CrossRef] [Google Scholar] 22. Ким М., Чун Дж. Структура бактериального сообщества в кимчи, корейской ферментированной овощной пище, по данным анализа гена 16S рРНК.Int. J. Food Microbiol. 2005. 103: 91–96. DOI: 10.1016 / j.ijfoodmicro.2004.11.030. [PubMed] [CrossRef] [Google Scholar] 23. Забат М.А., Сано В.Х., Кабрал Д.Дж., Вурстер Дж. И., Беленький П. Влияние веганского производства на микробиом кимчи. Food Microbiol. 2018; 74: 171–178. DOI: 10.1016 / j.fm.2018.04.001. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 24. Nguyen D.T.L., Van Hoorde K., Cnockaert M., De Brandt E., Aerts M., Binh Thanh L., Vandamme P. Описание микробиоты молочнокислых бактерий, связанной с производством традиционных ферментированных овощей во Вьетнаме.Int. J. Food Microbiol. 2013; 163: 19–27. DOI: 10.1016 / j.ijfoodmicro.2013.01.024. [PubMed] [CrossRef] [Google Scholar]

Почему вам следует использовать квашеную капусту для обогрева комнаты | Автор: Никко Онг

Подробное руководство Н. Онга и Дж. Онга

Спустя несколько месяцев после начала пандемии COVID-19 мы, человечество, увидели разные стороны каждой стороны жизни, адаптируясь к новым условиям. нормали и адаптация к быстро меняющимся условиям. Многие из нас слышали зов сирены проповедников закваски, и теперь стало нормой видеть, как пузырящиеся закваски засоряют каналы социальных сетей.Выпечка стала знаменем движения «оставайся дома», а закваска — его поборником. Как бы я ни считал себя начинающим пекарем, я считаю себя одним из тех многочисленных и неудачников, которые выбросили не один неудачный закусочный. Они могут быть непослушными, непослушными и непослушными созданиями, непостоянными. Вот почему я бы предложил такую ​​же первобытную альтернативу ферментации, которая будет прочной и неутомимой, прочной и безжалостной. Скромный принц бактериального брожения: наш надежный друг, квашеная капуста.

Все мы знаем квашеную капусту. Эта восхитительная, необычная, кисло-квашеная капуста, нанесенная по всему вкусу, станет прекрасным сопровождением или центральным элементом трапезы. Квашеная капуста — это не просто то, что вы едите со свининой на Новый год или фаршируете Рувим солониной, это электростанция сама по себе во всех смыслах этого слова. Основные процессы бактериального брожения (например, кимчи, соленые огурцы, йогурт, сыр, соевый соус, салями и, да, закваска) происходят с поразительной регулярностью и удивительной простотой в блюде, состоящем исключительно из капусты и соли.Помассируйте нашинкованный кочан капусты с небольшим количеством соли и оставьте его на некоторое время погруженным в собственную вытесненную воду, чтобы создать основу для брожения, на которой построили все человеческие цивилизации, и будет продолжать это делать до тех пор, пока мы существуем. Как показала эта пандемия, мы — вид, судьба которого связана с красочными нитями брожения.

Квашеная капуста — это пища, которая питает не только наш вкус и культурную историю, но и микробиомы кишечника, содержащую миллионы и миллионы здоровых пробиотиков, которые, по мнению некоторых, будут делать все, от борьбы с воспалением до снижения риска рака.Несмотря на бесчисленные преимущества, которые мы получаем от ее обильных берегов, пожалуй, самым недооцененным вкладом квашеной капусты является ее способность обеспечивать наши дома естественным теплом. Защитите эти холодные зимние ночи теплой квашеной капустой, рюмкой полезного для кишечника сока краута и обогревателем, подключенным не к розетке, а к теплым стенам живого брожения.

Приготовление квашеной капусты является одним из самых простых способов брожения. По своей сути квашеная капуста представляет собой смесь нашинкованной капусты и 2% ее массы, содержащей соль.Он не требует кормления по расписанию или специальных ингредиентов, таких как взорванный стартер, и с того момента, как он помещен в банку, процесс становится автоматическим. Комбинация механического давления при перемешивании или массировании капусты и осмоса из-за добавления соли заставляет капусту вытеснять воду внутри своих клеточных стенок, высвобождая ферментируемые сахара и питательные вещества, которые помогают в процессе ферментации. Этот богатый питательными веществами нектар погружает капусту в воду, не позволяя воздуху достигать основной части ферментации.Не допускайте попадания воздуха в капустную смесь, чтобы предотвратить рост нежелательных микроорганизмов, одновременно способствуя процессу брожения. Простота производства квашеной капусты противоречит сложности вкуса, который является результатом непрерывной работы множества микроскопических бактерий, которые непрерывно живут, работают и умирают во время молочнокислого брожения.

Квашеная капуста — это древний ферментированный продукт из капусты, который приобретает кислый («квашеный») вкус из-за процесса, называемого молочнокислым брожением (LAF), который включает образование кислой молочной кислоты для уничтожения вредных микробов и сохранения пищи на долгое время. к месяцам за раз.Этот процесс превращает глюкозу (C6h22O6) в молочную кислоту через пути, созданные несколькими штаммами молочнокислых бактерий. В природе молочнокислые бактерии существуют повсюду: между листьями капусты, на наших пальцах и в воздухе. Многонедельная продолжительность жизни активного LAF включает в себя рост и падение нескольких культур молочнокислых бактерий, что сродни быстрой смене династий в геополитическом регионе, где много споров. Будь то конфликт или прямая наследственность, монархии и бактерии показывают нам, что в любой истории есть гораздо больше, чем точная композиция в текущий момент, и что для получения полной картины нам нужно смотреть на вещи через призму изменяющейся во времени.

Фото CDC на Unsplash

Первым из наших суперзвездных бактериальных штаммов является Leuconostoc mesenteroides , пружинящий гетероферментер-выскочка, что означает, что он производит несколько продуктов, включая молочную кислоту, этанол и газ. L. mesenteroides обладает сильной солеустойчивостью, что означает, что он может переносить довольно высокую 2% -ную соленость ферментации, в то время как другие бактерии — нет. Этот газообразующий кокк быстро снижает pH раствора соли и капустного сока, что помогает подавить действие других микроорганизмов и подготовить почву для новой волны молочнокислых бактерий.

Когда pH раствора достигает 4–4,5, L. mesenteroides отмирает, отдавая свою жизнь другим. Созданная им кислота обеспечивает благоприятную среду для Бонни и Клайда в мире ферментации капусты, двух бацилл, которые не берут в плен, которые мы называем Lactobacillus plantarum и Lactobacillus brevis . В то время как L. Brevis является гетероферментером, как L. mesenteroides , L. plantarum врывается, как левша, гомоферментер сосредоточился только на одном: создании большего количества кислоты. L. plantarum — заметный штамм бактерий в процессе приготовления квашеной капусты, поскольку он создает 2 моля молочной кислоты на каждый моль глюкозы, производя большую кислотность, которая придает квашеной капусте характерный привкус.

Эти лактобациллы будут продолжать производить все больше и больше молочной кислоты в растворе, пока его pH не достигнет 3,6, после чего они уступят место Lactobacillus pentoaceticus , что завершает процесс ферментации. На этой стадии любое количество произведенной молочной кислоты подавляет рост молочнокислых бактерий из-за очень кислых условий, и, таким образом, ферментация достигает своего рода равновесия, определяя границу между высокоразвитыми профилями вкуса и неконтролируемым гниением.

Один из важных выводов гетероферментеров и гомоферментеров состоит в том, что оба они представлены химическими реакциями, которые имеют реагенты, продукты и некоторую форму передачи энергии. По закону Гесса мы можем видеть, что энтальпии образования продуктов ниже, чем энтальпии образования реагентов, что означает, что во время реакции должна выделяться некоторая энергия, чтобы сбалансировать уравнение — это экзотермическая реакция. Другими словами, молочнокислые бактерии превращают капусту в квашеную капусту и при этом выделяют энергию в виде тепла.

( L. mesenteroides ) Гетероферментатор:

Гетероферментативная реакция

Эта экзотермическая реакция имеет стандартную энтальпию реакции приблизительно -91,88 кДж / моль израсходованной глюкозы.

(L. plantarum ) Гомоферментатор:

Гомоферментативная реакция

Стандартная энтальпия реакции составляет приблизительно -114,86 кДж / моль глюкозы.

Мы видим, что гомолактическая ферментация с L. plantarum дает больше энергии, чем гетеролактическая ферментация с L.mesenteroides и L. brevis , а также учитывая несколько ключевых идей о процессе производства квашеной капусты, мы наконец можем задать вопрос, который мы все должны задать. Сколько капусты нужно для обогрева комнаты квашеной капустой?

В этом анализе мы стремимся показать, что экзотермический характер молочнокислого брожения квашеной капусты может обеспечить мощность, достаточную для замены стандартного электрического обогревателя. Для этой модели мы предположим, что мы хотим генерировать 800 Вт, что является разумной номинальной мощностью для портативной керамической системы обогрева, которую можно использовать для обогрева комнаты.Спрашивайте не о том, что вы можете сделать с квашеной капустой, а о том, что квашеная капуста может для вас сделать. Он может многое.

Рассматривая среднее значение энтальпии реакции для гомоферментативного и гетероферментативного процессов, мы получаем 103,37 кДж / моль глюкозы в качестве стандартного тепла, выделяемого в процессе ферментации. Основываясь на нескольких рецептах ферментации квашеной капусты, мы можем предположить, что при комнатной температуре время завершения процесса ферментации составляет примерно 2 недели.

Ср. выделенная энергия = 103.37 кДж / моль глюкозы

Время до завершения ферментации = 2 недели = 1 209 600 с

На каждый моль расщепленной глюкозы в процессе ферментации квашеной капусты выделяется 103 370 Дж энергии. Этой энергии более чем достаточно, чтобы сжечь 2,63 грамма жира! Поскольку мы хотим приравнять выделение энергии к мощности, измеряемой в ваттах [Вт], нам необходимо преобразовать выделение энергии в единицу времени.

Ср. мощность брожения = 0,085 Вт / моль глюкозы

Работа в молях не очень полезна при работе с реальными величинами, такими как количество кочанов, поэтому нам нужно преобразовать нашу задачу, чтобы иметь дело с граммами глюкоза вместо молей глюкозы.

Молярный вес глюкозы = 180,15 г / моль глюкозы

Сред. мощность брожения = 0,000474 Вт / г глюкозы

На следующем этапе требуется некоторая информация о питательных веществах капусты и квашеной капусты. Капуста превращается в квашеную капусту, поскольку молочнокислые бактерии потребляют доступный сахар в капусте, производя молочную кислоту, энергию и вторичные продукты. Данные о питании дают нам количество сахара в стандартной сырой капусте, но не весь этот сахар потребляется в процессе ферментации.В квашеной капусте все еще есть сахар, хотя она далеко не сладкая. Используя информацию о питании квашеной капусты и сопоставив таблицы статического брожения глюкозы, мы можем увидеть, что большая часть, но не весь сахар превращается в молочную кислоту.

Глюкоза в сырой капусте = 0,032 г глюкозы / г капусты

Потребление глюкозы при ферментации = 85%

Эффективное потребление глюкозы = 0,0272 г глюкозы / г капусты

На этом этапе мы видим, что наша сила ферментации может теперь быть выраженным в граммах необходимой сырой капусты.Это позволяет нам лучше понять, сколько капусты нам нужно для обогрева комнаты.

Ср. мощность брожения = 0,0000129 Вт / г капусты

Учитывая обогреватель мощностью 800 Вт, сколько капусты нам нужно, чтобы произвести такое же количество тепла? Ответ: 62 001 559 граммов капусты. Это 45 Toyota Prii квашеной капусты, необходимых для замены всего лишь одного небольшого обогревателя!

Учитывая, что большой кочан капусты в среднем весит 1106 граммов, мы видим, что нам потребуется 56 060 кочанов.Это приводит нас к новой единице измерения, которую мы назовем CPW, или капуста на ватт, новой единицей мощности.

800 Вт эквивалент = 62 001,56 кг капусты

CPW¹⁴ (дни ферментации) = 70,074 капусты / Вт

Кто-то может сказать, что такое количество капусты неразумно, и что покупка 62000 кг капусты является социальной ошибкой, особенно когда он должен использоваться исключительно для замены комнатного обогревателя. Для тех, кто уже ненавидит вкус капусты или квашеной капусты, это, безусловно, непростая задача.Тем не менее, это важное число для любого предприимчивого человека, мечтающего о квашеной капусте, и если этот предприимчивый человек подумает о продаже своей квашеной капусты помимо получения 800 Вт мощности нагрева, он должен прочитать раздел Действительно ли оно того стоит ? в приложении.

На исходный вопрос еще предстоит дать четкий ответ, несмотря на большой объем текста, который, возможно, убедил или не убедил вас в том, что квашеная капуста стоит вашего времени. Стоит ли обогревать комнату квашеной капустой? Ответ не совсем ясен.По всем направлениям современного диалога предстоит вести бесчисленные дебаты, охватывающие политические, экологические и практические вопросы. Химические реакции оказали влияние на культуру точно так же, как действие бактерий влияет на политику и восприятие. Кочанная капуста, которую вы, возможно, захотите сбродить, возможно, была доведена до созревания фермерами, получившими несправедливую компенсацию, а углекислый газ, образующийся в результате ферментации, может значительно увеличить ваш углеродный след. Воздействие каждого предпринимаемого нами действия может спровоцировать череду событий, имеющих настолько далеко идущие последствия, что мы заикаемся, парализованные потоком информации.

Решаем ли мы, люди, участвовать в ссоре, полностью зависит от нас. Выбираем ли мы ферментацию капусты для приготовления квашеной капусты — это тоже наш выбор. Вместо того, чтобы уменьшать масштаб и рассматривать макромасштаб, забитый столкновениями невежественных армий ночью, увеличьте масштаб очень близко. Вы увидите изящные детали, которые наполняют всех нас детским удивлением, и сумасшедшие приложения, которые настолько безумны, что могут просто работать. Увеличьте масштаб еще ближе и насладитесь радостью исследований и прогуляйтесь по научным залам, как постоянно растущий музей.Даже самые незначительные детали будут кричать, говоря вам, что «Я большой, я вмещаю множество». Послушайте их, эту капусту в супермаркете, эти крошечные звездочки в небе.

Использование квашеной капусты для обогрева комнаты вполне может оказаться фарсом, особенно если рассматривать ее под видом практичности. Однако я считаю, что истинная ценность подогрева квашеной капусты — это внутренняя ценность, искренняя признательность за красоту окружающего нас мира. С 56000 кочан капусты или без них, эта красота достаточно провокационная, чтобы по крайней мере задуматься о том, как бы выглядела жизнь с комнатным обогревателем из квашеной капусты.

Сохранять прохладу

Конечно, всех беспокоит возможность бактериального самоубийства из-за тепла, генерируемого ферментацией. Очень простой взгляд на теплопередачу ферментации должен решить эту проблему.

Ферментация будет происходить в большом резервуаре HDPE на 1000 галлонов со следующими характеристиками:

  • Внутренний радиус: 0,8128 м
  • Внешний радиус: 0,8106 м
  • Высота (L): 1,9685 м
  • Теплопроводность (K) ПЭНД: 0.465 Вт / (м · К)

Предполагая, что температура системы составляет 20 градусов Цельсия (идеальная температура для распространения L. mesenteroides ) и коэффициент конвективной теплопередачи (ч) для воздуха составляет 100 Вт / (м² · К) , модель затем сильно упрощается до цилиндрической оболочки с предположительно присутствующими только теплопроводным (от резервуара) и конвективным сопротивлениями.

Дальнейшие предположения для упрощения:

  • Теплопередача в стационарном состоянии в одномерном (радиальном)
  • Нет контактного сопротивления или излучения
  • Постоянные свойства на всем протяжении

Если 35 баков баков вырабатывают 800 Вт, мощность на каждый барабан составляет 22.86 Вт — это выделяемое тепло (Q).

Теплопередача в бочке с квашеной капустой

Конвективное термическое сопротивление:

Конвективное термическое сопротивление

Тепловое сопротивление проводимости от стенок резервуара:

Теплопроводное сопротивление

Зная, что теплопередача определяется разницей температур по тепловым сопротивлениям (Q = deltaT / R), мы можем использовать простое уравнение, чтобы найти внутреннюю температуру капусты. В результате температура капусты составляет 20,03 ° C, что лишь на долю градуса выше температуры окружающей среды.

Практически незначительное изменение температуры должно успокоить любого, кто беспокоится о своей капусте, поскольку бактерии могут действовать без опасений. Даже резкое изменение коэффициента теплопередачи и теплопроводности приводит к небольшому изменению температуры.

Вы могли подумать, что это большая работа напрасно. 45 автомобилей среднего размера с капустой не могут оправдать замену небольшого керамического обогревателя на устойчивый и экологически чистый источник пробиотического тепла.Какими бы ни были ваши сомнения, а я уверен, что их много, мы увидим, что числа , , настоятельно побуждают вас принять участие в операции по приготовлению квашеной капусты. Это действительно того стоит.

Мы разберем затраты, связанные с непрерывной эксплуатацией обогревателя в течение двух недель, и сравним их с затратами и преимуществами производства и продажи такого большого количества квашеной капусты.

Space Heater

Базовая стоимость = 69,99 долларов США
С налогом = 74,19 долларов США
Стоимость электроэнергии в Пенсильвании = 0 долларов США.1375 / кВтч
Стоимость электроэнергии за 14 дней = 36,96 долларов США
Общая стоимость = 111,15 долларов США

Квашеная капуста

Мы можем разбить процесс производства квашеной капусты на постоянные затраты, переменные затраты, труд и доход. Сумма этих факторов составляет общую прибыль / операционный убыток от квашеной капусты.

Фиксированные затраты

Предполагая, что каждый большой кочан капусты после измельчения дает объем в 10 чашек, мы можем вычислить, сколько хранилищ нам потребуется для ферментации кочанов.

Общий объем нашинкованной капусты = 132,6295 м³ = 35037 галлонов

Это невероятное количество капусты, которое почти заполнит бассейн размером 20 х 40 х 6 дюймов. Действительно, что может быть лучше для подземного бассейна? Мы можем разделить капусту на 35 целых пластиковых бочек по 1000 галлонов. Несмотря на то, что объем кочанной капусты резко уменьшается по мере того, как применяется соль и удаляется вода, мы будем использовать 35 бочек, чтобы обеспечить избыточное пространство для хранения в случае изменения размера капусты.

Стоимость резервуара = 647 долларов США
Количество резервуаров = 35
Стоимость резервуаров = 22 645 долларов США
Налог с продаж в PA = 6%
Общая фиксированная стоимость = 24 003,70 долларов США

Переменные затраты

Квашеная капуста состоит всего из двух простых ингредиенты: соль и капуста. Добавьте время, и вы получите один из самых мощных традиционных источников полезных кишечных бактерий и вкуса.

2016 ориентировочные затраты на переработку тонны выращенной в Америке капусты составили 228 долларов.В то время как международные источники, такие как Alibaba, поставляют капусту по цене от 150 до 400 долларов, стоимость доставки и объем торговли могут быть непомерно высокими для некоторых цепочек поставок квашеной капусты.

Поскольку квашеная капуста обычно делается с соленостью 2%, нам потребуется 2 грамма соли на каждые 100 граммов капусты, или всего 1240 кг соли. Стоимость розовой гималайской соли была взята из оптовых упаковок на Amazon.

Стоимость капусты = 228 долларов за тонну
Общая стоимость капусты = 15 582,66 долларов
Стоимость гималайской розовой соли = 2 доллара.56 / кг
Общая стоимость соли = 3 174,48 доллара США
Общая стоимость сырья = 18 757,14 доллара США

Трудозатраты

Чтобы переработать всю эту капусту, было бы лучше приобрести промышленную машину, чтобы ее измельчить. В этом случае, однако, мы рассмотрим низкие первоначальные бизнес-расходы и вместо этого просто наймем рабочих для выполнения ручного труда. Поскольку это неквалифицированная работа, мы будем платить рабочим сверх минимальной заработной платы в Пенсильвании (7,25 доллара в час) и требовать, чтобы они могли обработать (мыть, измельчить и натереть солью) капусту менее чем за 12 минут.Наш анализ предполагает общие затраты на рабочую силу, которые можно разделить между несколькими работниками в течение года или большим количеством членов сообщества в течение короткого периода.

Трудозатраты = 8,50 долларов США / час
Время обработки = 12 минут = 0,2 часа
Общее количество часов, необходимых для обработки всей капусты = 11 211,9 часов
Общие затраты на рабочую силу = 95 300,77 долларов США

Предполагая, что переработка капусты происходит на предприятии отдельно от помещения, мы Если вы хотите нагреть при брожении квашеной капусты, нам необходимо следить за тем, чтобы капуста хранилась в идеальных условиях для брожения, используя кондиционер или обогреватель в течение всего года.

Мощность для большого блока переменного тока / нагревателя = 1440
Часы в году = 8760 часов
Общие затраты на поддержание стабильной температуры круглый год = 1734,50 долларов США

Эти затраты являются необязательными, поскольку они могут не относиться к конкретному бизнес-модель, скажем, если бы переработка капусты должна была происходить в течение более короткого периода времени, но они включены в расчеты, чтобы добавить дополнительное место для ошибки.

Доход

Сравнивая эту квашеную капусту с основными конкурентами на рынке, мы можем установить разумную цену на продажу квашеной капусты, произведенной в этом приключении по обогреву помещений.

Сравнение цен на текущем рынке

Мы видим, что Wildbrine имеет самую низкую стоимость из трех основных поставщиков квашеной капусты на рынке, поэтому мы установили ту же стоимость для нашего продукта из квашеной капусты. Общие расчеты, выполненные до сих пор, были необходимы для капусты, поэтому нам нужно будет пересчитать объемы капусты и квашеной капусты для продажи. В большинстве рецептов 3 фунта капусты приравниваются к конечному продукту — 4 чашкам квашеной капусты, что является несовершенным преобразованием во многих отношениях, но будет служить нашим целям для этого широкого анализа.

Конверсия квашеной капусты = 2,268 г квашеной капусты / г квашеной капусты
Всего произведено квашеной капусты = 27 333,5 кг квашеной капусты

Предполагая, что мы сохраним только 70% этих продаж за счет маркетинговых, рекламных и дистрибьюторских сборов, мы можем рассчитать окончательный выручка от продажи квашеной капусты.

Общая выручка = 171 781,66 долларов США

Общая прибыль

Общая прибыль от использования квашеной капусты для обогрева комнаты с учетом затрат и выгод, связанных с производством квашеной капусты, представляет собой сумму постоянных затрат, переменных затрат и рабочей силы. , и доход.

Общая прибыль = — 24 003,70 долларов — 18 757,14 долларов — (95 300,77 долларов США + 17,34,50 долларов США) + 171 781,66 долларов США
Общая прибыль = 31 985,57 долларов США. думать, что любой, у кого есть предпринимательский дух и свободное время, когда-либо подумает о покупке обогревателя. При этом мы признаем и поддерживаем способы, которыми мы можем использовать технологии, чтобы облегчить нашу жизнь, и обогреватели, безусловно, легче.Однако, если в мире закончатся обогреватели или вся связь с сетью будет потеряна, приятно знать, что есть больше вещей, чем костры, вокруг которых мы можем ткнуться.

Рецепт гундрука (пряные ферментированные овощи) — ферментация

На главную & nbsp / & nbsp Овощи и орехи & nbsp / & nbsp Рецепт Гундрука (Пряные ферментированные овощи)

Это кимчи из Непала, приготовленное из овощей летнего урожая и хранящееся в качестве основного продукта в холодные месяцы.Из него также иногда делают карри, но этот маринованный огурчик отлично подходит к дхалу и рису и добавляет пикантности вашим блюдам. Вы также можете подавать его с рисом или пловом, приготовленным на пару, и масала-дахи.

Это отличный рассол для бургера. Попробуйте панир, баклажаны на гриле и гундрук в свой следующий вегетарианский бургер.

Регион: Непал

Приготовление: 1 банка емкостью 1 литр (35 жидких унций / 4 стакана)
Приготовление: 20 минут + 6 дней ферментации
Сложность: Легкая

Состав:

  • 500 г (1 фунт 2 унции) пекинской капусты (вонг бок)
  • 500 г (1 фунт 2 унции) дайкон (белый редис)
  • 200 г (7 унций) моркови
  • 4 столовые ложки крупной соли
  • 4 зеленых лука (зеленый лук), нарезанных на отрезки длиной 5 см (2 дюйма)
  • 1 столовая ложка крупно нарезанного чеснока
  • 1 столовая ложка тонко нарезанного свежего имбиря
  • 1 столовая ложка хлопьев чили
  • 1 столовая ложка мягкого порошка кашмирского чили
  • 1 чайная ложка черного перца
  • 1 чайная ложка горошин сычуаньского перца
  • 1/4 чайной ложки асафетиды
  • 2 столовые ложки сахара

Направление:

  1. Нарежьте капусту квадратами по 5 см (2 дюйма), а дайкон и морковь — тонкими ломтиками длиной около 5 см (2 дюйма).Поместите их в большую миску, добавьте 3 столовые ложки соли и тщательно перемешайте. Накрыть крышкой и оставить в теплом месте минимум на 6 часов.
  2. Слейте овощи на дуршлаг и хорошо промойте, затем верните их в миксерную чашу. Добавьте оставшиеся ингредиенты, включая оставшуюся 1 столовую ложку соли, и 250 мл (9 жидких унций / 1 стакан) воды. Хорошо перемешайте, чтобы овощи смешались со всеми специями.
  3. Перелейте смесь в большую стерилизованную банку, постепенно надавливая на каждый слой по мере того, как он засыпается ложкой, чтобы все уложилось; смесь со временем распадется.
  4. Поместите кусок муслина (марли) на банку и закрепите его резинкой. В первые дни держите банку в миске, так как часть жидкости из овощей выльется через край.
  5. Через 3 дня плотно закройте банку и оставьте для брожения в теплом месте минимум на 3 дня.
  6. Когда овощи достаточно ферментируются по вашему вкусу, храните банку в холодильнике. Такой маринад хранится до 4 недель.

Также из

Lands of the Curry Leaf :

Известный шеф-повар, автор и телеведущий Питер Курувита делится более чем 100 вегетарианскими и веганскими рецептами, которые отправляют нас в кулинарное путешествие по субконтиненту — от Бутана, Непала и Афганистана до Индии, Пакистана, Бангладеш и его родной страны Шри-Ланка.Все блюда из этой глубоко личной коллекции, приправленные ароматами жизни и путешествий Петра, отражают разнообразие регионов, их легендарное гостеприимство, их энергию и азарт, необычные пейзажи и богатую историю. Питер исследует золотую жилу растительных ароматов в рецептах уличной еды; бобовые и бобовые; салаты; блюда на молочной основе; карри, жаркое и рагу; рис; супы; чатни; и соусы. Эта книга является отражением меняющегося диалога о том, что мы едим, поскольку мир принимает идею еды, в которой мясо не является главным событием.

Перепечатано с разрешения книги Lands of the Curry Leaf: A Vegetarian Food Journey из Шри-Ланки в Непал Питера Курувиты и опубликовано Murdoch Books, 2019.

Опубликовано 3 октября 2019 г.

СТАТЬИ ПО ТЕМЕ

Используйте этот рассол для вегетарианского бургера или приготовьте его из капусты, редиса, дайкона, коль раби или другой листовой азиатской зелени.

Исследуйте одну из самых редких в мире заквасок, верблюжье молоко, с мастером-сыроделом и узнайте историю этой жидкости, о которой часто забывают.

Сделайте кимчи сложной текстуры и вкуса, добавив в рецепт зимнюю тыкву и кольраби.

Вдохновение для пищевой алхимии.

Подписывайтесь на нашу новостную рассылку

Copyright 2021, Все права защищены | Ogden Publications, Inc.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

2022© ООО "ИФК Аптеки"
Все права защищены.
Использование материалов с сайта без согласования с администрацией сайта запрещено.